EMAIL THIS PAGE TO A FRIEND

FREM3

FRAS1 related extracellular matrix 3

88 Gene Product Result for
UniProtKB ID: P0C091
Gene ID:
Mouse(333315) Fras1 related extracellular matrix protein 3
Rat(307767) FRAS1 related extracellular matrix 3
Zebrafish(564383) Fras1 related extracellular matrix 3
cow(781161) FRAS1 related extracellular matrix 3
Horse(100071126) FRAS1 related extracellular matrix 3
domestic cat(101087833) FRAS1 related extracellular matrix 3
sheep(101104095) FRAS1 related extracellular matrix 3
Domestic Rabbit(100344084) FRAS1 related extracellular matrix 3
domestic guinea pig(100733911) FRAS1 related extracellular matrix 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001168235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001168235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001168235 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU154731 MISSION® esiRNA esiRNA targeting mouse Frem3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001127662 Rosetta Predictions human pricing
XM_001720656 Rosetta Predictions human pricing
XM_094074 Rosetta Predictions human pricing
XM_001074070 Rosetta Predictions rat pricing
XM_226381 Rosetta Predictions rat pricing
XM_906331 Rosetta Predictions mouse pricing
XM_984073 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001127662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00384095 predicted 4615
2 SASI_Hs02_00384096 predicted 2978
3 SASI_Hs02_00384097 predicted 5998
4 SASI_Hs02_00384098 predicted 4409
5 SASI_Hs02_00384099 predicted 2853
6 SASI_Hs02_00384100 predicted 3965
7 SASI_Hs02_00384101 predicted 776
8 SASI_Hs02_00384102 predicted 2211
9 SASI_Hs02_00384103 predicted 2537
10 SASI_Hs02_00384104 predicted 4846
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00438037 predicted 4622
2 SASI_Hs02_00438038 predicted 2979
3 SASI_Hs02_00438039 predicted 5996
4 SASI_Hs02_00438040 predicted 4409
5 SASI_Hs02_00438041 predicted 2856
6 SASI_Hs02_00438042 predicted 3960
7 SASI_Hs02_00438043 predicted 783
8 SASI_Hs02_00438044 predicted 2206
9 SASI_Hs02_00438045 predicted 2542
10 SASI_Hs02_00438046 predicted 4842
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_094074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478839 predicted 4614
2 SASI_Hs01_00253701 predicted 2976
3 SASI_Hs01_00253704 predicted 2576
4 SASI_Hs02_00478840 predicted 4402
5 SASI_Hs02_00478841 predicted 2851
6 SASI_Hs01_00253705 predicted 3961
7 SASI_Hs02_00478842 predicted 781
8 SASI_Hs01_00253706 predicted 2204
9 SASI_Hs01_00253707 predicted 2543
10 SASI_Hs02_00478843 predicted 4840
11 SASI_Hs01_00253699 predicted 5759
12 SASI_Hs01_00253700 predicted 2735
13 SASI_Hs01_00253702 predicted 6450
14 SASI_Hs01_00253703 predicted 6838
15 SASI_Hs01_00253708 predicted 6627
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344957 predicted 3919
2 SASI_Rn02_00344958 predicted 5464
3 SASI_Rn02_00344959 predicted 5004
4 SASI_Rn02_00344960 predicted 2265
5 SASI_Rn02_00344961 predicted 1568
6 SASI_Rn02_00344962 predicted 2922
7 SASI_Rn02_00344963 predicted 2488
8 SASI_Rn02_00344964 predicted 5250
9 SASI_Rn02_00344965 predicted 2734
10 SASI_Rn02_00344966 predicted 4084
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383493 predicted 3920
2 SASI_Rn02_00383494 predicted 5464
3 SASI_Rn02_00383495 predicted 4999
4 SASI_Rn02_00383496 predicted 4222
5 SASI_Rn02_00383497 predicted 2924
6 SASI_Rn02_00383498 predicted 4186
7 SASI_Rn02_00383499 predicted 5254
8 SASI_Rn02_00383500 predicted 2733
9 SASI_Rn02_00383501 predicted 4090
10 SASI_Rn02_00383502 predicted 5487
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432457 predicted 2466
2 SASI_Mm02_00432458 predicted 5312
3 SASI_Mm02_00432459 predicted 4535
4 SASI_Mm02_00432460 predicted 3969
5 SASI_Mm02_00432461 predicted 795
6 SASI_Mm02_00432462 predicted 4325
7 SASI_Mm02_00432463 predicted 3159
8 SASI_Mm02_00432464 predicted 5590
9 SASI_Mm02_00432465 predicted 932
10 SASI_Mm02_00432466 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_984073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00448311 predicted 2463
2 SASI_Mm01_00211587 predicted 5311
3 SASI_Mm01_00211588 predicted 4531
4 SASI_Mm01_00211589 predicted 3969
5 SASI_Mm02_00448312 predicted 4155
6 SASI_Mm01_00211591 predicted 4327
7 SASI_Mm01_00211592 predicted 3156
8 SASI_Mm01_00211594 predicted 5595
9 SASI_Mm01_00211596 predicted 1292
10 SASI_Mm02_00448313 predicted 4308
11 SASI_Mm01_00211590 predicted 807
12 SASI_Mm01_00211593 predicted 1931
13 SASI_Mm01_00211595 predicted 934
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001168235
FREM3 MISSION shRNA Bacterial Glycerol Stock
FRAS1 related extracellular matrix 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-2081s21c1
Sequence:CCGGAGGTCCAACCAGTGGATATACCTCGAGGTATATCCACTGGTTGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-1622s21c1
Sequence:CCGGATGAACCACCAATGGTCAATACTCGAGTATTGACCATTGGTGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-6004s21c1
Sequence:CCGGACTATTCTGGCTGATCGTTATCTCGAGATAACGATCAGCCAGAATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-4247s21c1
Sequence:CCGGATGTCACCATTGGCAACTTAGCTCGAGCTAAGTTGCCAATGGTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-1697s21c1
Sequence:CCGGTACTGAGTGCTACTGATATTGCTCGAGCAATATCAGTAGCACTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-4945s21c1
Sequence:CCGGAGGGTCCAGATAAGATCATTACTCGAGTAATGATCTTATCTGGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-5744s21c1
Sequence:CCGGGCCAGGAACTAATCGTCATTTCTCGAGAAATGACGATTAGTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168235.1-6523s21c1
Sequence:CCGGGTACTGTCATTGGTGTTATATCTCGAGATATAACACCAATGACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001168235
FREM3 MISSION shRNA shRNA Plasmid DNA
FRAS1 related extracellular matrix 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-2081s21c1
Sequence:CCGGAGGTCCAACCAGTGGATATACCTCGAGGTATATCCACTGGTTGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-1622s21c1
Sequence:CCGGATGAACCACCAATGGTCAATACTCGAGTATTGACCATTGGTGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-6004s21c1
Sequence:CCGGACTATTCTGGCTGATCGTTATCTCGAGATAACGATCAGCCAGAATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-4247s21c1
Sequence:CCGGATGTCACCATTGGCAACTTAGCTCGAGCTAAGTTGCCAATGGTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-1697s21c1
Sequence:CCGGTACTGAGTGCTACTGATATTGCTCGAGCAATATCAGTAGCACTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-4945s21c1
Sequence:CCGGAGGGTCCAGATAAGATCATTACTCGAGTAATGATCTTATCTGGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-5744s21c1
Sequence:CCGGGCCAGGAACTAATCGTCATTTCTCGAGAAATGACGATTAGTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168235.1-6523s21c1
Sequence:CCGGGTACTGTCATTGGTGTTATATCTCGAGATATAACACCAATGACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001168235
FREM3 MISSION shRNA Lentiviral Transduction Particles
FRAS1 related extracellular matrix 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-2081s21c1
Sequence:CCGGAGGTCCAACCAGTGGATATACCTCGAGGTATATCCACTGGTTGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-1622s21c1
Sequence:CCGGATGAACCACCAATGGTCAATACTCGAGTATTGACCATTGGTGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-6004s21c1
Sequence:CCGGACTATTCTGGCTGATCGTTATCTCGAGATAACGATCAGCCAGAATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-4247s21c1
Sequence:CCGGATGTCACCATTGGCAACTTAGCTCGAGCTAAGTTGCCAATGGTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-1697s21c1
Sequence:CCGGTACTGAGTGCTACTGATATTGCTCGAGCAATATCAGTAGCACTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-4945s21c1
Sequence:CCGGAGGGTCCAGATAAGATCATTACTCGAGTAATGATCTTATCTGGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168235.1-5744s21c1
Sequence:CCGGGCCAGGAACTAATCGTCATTTCTCGAGAAATGACGATTAGTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168235.1-6523s21c1
Sequence:CCGGGTACTGTCATTGGTGTTATATCTCGAGATATAACACCAATGACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks