EMAIL THIS PAGE TO A FRIEND

FRG1

FSHD region gene 1

57 Gene Product Result for
Synonyms: FRG1A FSG1
UniProtKB ID: Q14331, A8K775
Gene ID:
Human(2483) Summary: This gene maps to a location 100 kb centromeric of the repeat units on chromosome 4q35 which are deleted in facioscapulohumeral muscular dystrophy (FSHD). It is evolutionarily conserved and has related sequences on multiple human chromosomes but DNA sequence analysis did not reveal any homology to known genes. In vivo studies demonstrate the encoded protein is localized to the nucleolus. [provided by RefSeq, Jul 2008]
Mouse(14300) FSHD region gene 1
Rat(689484) FSHD region gene 1
chicken(422726) FSHD region gene 1
cow(512533) FSHD region gene 1
dog(482899) FSHD region gene 1
domestic guinea pig(100717741) FSHD region gene 1
naked mole-rat(101724089) FSHD region gene 1
Goat(100861075) FSHD region gene 1
sheep(101117645) FSHD region gene 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013522 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013522 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013522 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004477 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004477 Rosetta Predictions human pricing
XM_001070964 Rosetta Predictions rat pricing
NM_013522 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337690 predicted 509
2 SASI_Hs01_00097899 predicted 556
3 SASI_Hs02_00337691 predicted 641
4 SASI_Hs02_00337692 predicted 722
5 SASI_Hs02_00337693 predicted 797
6 SASI_Hs02_00337694 predicted 534
7 SASI_Hs02_00337695 predicted 651
8 SASI_Hs02_00337696 predicted 735
9 SASI_Hs02_00337697 predicted 713
10 SASI_Hs02_00337698 predicted 634
11 SASI_Hs01_00097898 predicted 560
12 SASI_Hs01_00097900 predicted 935
13 SASI_Hs01_00097901 predicted 473
14 SASI_Hs01_00097902 predicted 934
15 SASI_Hs01_00097903 predicted 476
16 SASI_Hs01_00097904 predicted 982
17 SASI_Hs01_00097905 predicted 477
18 SASI_Hs01_00097906 predicted 201
19 SASI_Hs01_00097907 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333428 predicted 524
2 SASI_Rn02_00333429 predicted 525
3 SASI_Rn02_00333430 predicted 601
4 SASI_Rn02_00333431 predicted 512
5 SASI_Rn02_00333432 predicted 607
6 SASI_Rn02_00333433 predicted 515
7 SASI_Rn02_00333434 predicted 502
8 SASI_Rn02_00333435 predicted 599
9 SASI_Rn02_00333436 predicted 516
10 SASI_Rn02_00333437 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322213 predicted 440
2 SASI_Mm01_00020913 predicted 625
3 SASI_Mm01_00020914 predicted 523
4 SASI_Mm01_00020915 predicted 460
5 SASI_Mm01_00020916 predicted 563
6 SASI_Mm01_00020917 predicted 650
7 SASI_Mm01_00020918 predicted 562
8 SASI_Mm01_00020919 predicted 553
9 SASI_Mm01_00020920 predicted 497
10 SASI_Mm01_00020921 predicted 665
11 SASI_Mm01_00020912 predicted 604
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013522
VALIDATED
FRG1 MISSION shRNA Bacterial Glycerol Stock
FSHD region gene 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-598s21c1
Sequence:CCGGGGCTTTACTGGCCTCAAATAGCTCGAGCTATTTGAGGCCAGTAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-632s21c1
Sequence:CCGGTGTAATGAAGCAGGCGATATACTCGAGTATATCGCCTGCTTCATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-534s21c1
Sequence:CCGGTTGGGCGTTCGGATGCAATTGCTCGAGCAATTGCATCCGAACGCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-563s21c1
Sequence:CCGGGAACAATGGGAACCAGTGTTTCTCGAGAAACACTGGTTCCCATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-696s21c1
Sequence:CCGGTCAGATCCTGTGCGGAAAGAGCTCGAGCTCTTTCCGCACAGGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-431s21c1
Sequence:CCGGAGTCCTCCAGAGCAGTTTACTCTCGAGAGTAAACTGCTCTGGAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013522.1-233s1c1
Sequence:CCGGCCAACTTGATATTGTGGGAATCTCGAGATTCCCACAATATCAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013522.1-330s1c1
Sequence:CCGGGCACTGGACAATGGACTGTTTCTCGAGAAACAGTCCATTGTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013522.1-320s1c1
Sequence:CCGGCTATATCCATGCACTGGACAACTCGAGTTGTCCAGTGCATGGATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013522.1-286s1c1
Sequence:CCGGCAGGAACTATTGCCATTGAAACTCGAGTTTCAATGGCAATAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013522.1-862s1c1
Sequence:CCGGCCAAATTGAAAGCTGACCGATCTCGAGATCGGTCAGCTTTCAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013522
VALIDATED
FRG1 MISSION shRNA shRNA Plasmid DNA
FSHD region gene 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-598s21c1
Sequence:CCGGGGCTTTACTGGCCTCAAATAGCTCGAGCTATTTGAGGCCAGTAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-632s21c1
Sequence:CCGGTGTAATGAAGCAGGCGATATACTCGAGTATATCGCCTGCTTCATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-534s21c1
Sequence:CCGGTTGGGCGTTCGGATGCAATTGCTCGAGCAATTGCATCCGAACGCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-563s21c1
Sequence:CCGGGAACAATGGGAACCAGTGTTTCTCGAGAAACACTGGTTCCCATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-696s21c1
Sequence:CCGGTCAGATCCTGTGCGGAAAGAGCTCGAGCTCTTTCCGCACAGGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-431s21c1
Sequence:CCGGAGTCCTCCAGAGCAGTTTACTCTCGAGAGTAAACTGCTCTGGAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013522.1-233s1c1
Sequence:CCGGCCAACTTGATATTGTGGGAATCTCGAGATTCCCACAATATCAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013522.1-330s1c1
Sequence:CCGGGCACTGGACAATGGACTGTTTCTCGAGAAACAGTCCATTGTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013522.1-320s1c1
Sequence:CCGGCTATATCCATGCACTGGACAACTCGAGTTGTCCAGTGCATGGATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013522.1-286s1c1
Sequence:CCGGCAGGAACTATTGCCATTGAAACTCGAGTTTCAATGGCAATAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013522.1-862s1c1
Sequence:CCGGCCAAATTGAAAGCTGACCGATCTCGAGATCGGTCAGCTTTCAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013522
VALIDATED
FRG1 MISSION shRNA Lentiviral Transduction Particles
FSHD region gene 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-598s21c1
Sequence:CCGGGGCTTTACTGGCCTCAAATAGCTCGAGCTATTTGAGGCCAGTAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-632s21c1
Sequence:CCGGTGTAATGAAGCAGGCGATATACTCGAGTATATCGCCTGCTTCATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-534s21c1
Sequence:CCGGTTGGGCGTTCGGATGCAATTGCTCGAGCAATTGCATCCGAACGCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-563s21c1
Sequence:CCGGGAACAATGGGAACCAGTGTTTCTCGAGAAACACTGGTTCCCATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-696s21c1
Sequence:CCGGTCAGATCCTGTGCGGAAAGAGCTCGAGCTCTTTCCGCACAGGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013522.3-431s21c1
Sequence:CCGGAGTCCTCCAGAGCAGTTTACTCTCGAGAGTAAACTGCTCTGGAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013522.1-233s1c1
Sequence:CCGGCCAACTTGATATTGTGGGAATCTCGAGATTCCCACAATATCAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013522.1-330s1c1
Sequence:CCGGGCACTGGACAATGGACTGTTTCTCGAGAAACAGTCCATTGTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013522.1-320s1c1
Sequence:CCGGCTATATCCATGCACTGGACAACTCGAGTTGTCCAGTGCATGGATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013522.1-286s1c1
Sequence:CCGGCAGGAACTATTGCCATTGAAACTCGAGTTTCAATGGCAATAGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013522.1-862s1c1
Sequence:CCGGCCAAATTGAAAGCTGACCGATCTCGAGATCGGTCAGCTTTCAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004477
VALIDATED
FRG1 MISSION shRNA Bacterial Glycerol Stock
FSHD region gene 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000365019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004477.2-381s21c1
Sequence:CCGGATGGATAAGGGAACCTATATACTCGAGTATATAGGTTCCCTTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004477.2-338s21c1
Sequence:CCGGAGTAACAAACTTTGGTGAAATCTCGAGATTTCACCAAAGTTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004477.2-237s21c1
Sequence:CCGGGGAACCAAGACGAAGAGTAAGCTCGAGCTTACTCTTCGTCTTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004477.2-303s21c1
Sequence:CCGGGAAACCCAGCTTGATATTGTTCTCGAGAACAATATCAAGCTGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004477.2-631s21c1
Sequence:CCGGTGGCTTTGTTGGCCTCAAATACTCGAGTATTTGAGGCCAACAAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004477.1-737s1c1
Sequence:CCGGCTGTGCTGAAAGAGAAACCAACTCGAGTTGGTTTCTCTTTCAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004477.1-768s1c1
Sequence:CCGGGACATTCCAGAAGAAGACAAACTCGAGTTTGTCTTCTTCTGGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004477.1-484s1c1
Sequence:CCGGCGGCTGTCAAATTATCTGATTCTCGAGAATCAGATAATTTGACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004477
VALIDATED
FRG1 MISSION shRNA shRNA Plasmid DNA
FSHD region gene 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000365019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004477.2-381s21c1
Sequence:CCGGATGGATAAGGGAACCTATATACTCGAGTATATAGGTTCCCTTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004477.2-338s21c1
Sequence:CCGGAGTAACAAACTTTGGTGAAATCTCGAGATTTCACCAAAGTTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004477.2-237s21c1
Sequence:CCGGGGAACCAAGACGAAGAGTAAGCTCGAGCTTACTCTTCGTCTTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004477.2-303s21c1
Sequence:CCGGGAAACCCAGCTTGATATTGTTCTCGAGAACAATATCAAGCTGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004477.2-631s21c1
Sequence:CCGGTGGCTTTGTTGGCCTCAAATACTCGAGTATTTGAGGCCAACAAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004477.1-737s1c1
Sequence:CCGGCTGTGCTGAAAGAGAAACCAACTCGAGTTGGTTTCTCTTTCAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004477.1-768s1c1
Sequence:CCGGGACATTCCAGAAGAAGACAAACTCGAGTTTGTCTTCTTCTGGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004477.1-484s1c1
Sequence:CCGGCGGCTGTCAAATTATCTGATTCTCGAGAATCAGATAATTTGACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004477
VALIDATED
FRG1 MISSION shRNA Lentiviral Transduction Particles
FSHD region gene 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000365019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004477.2-381s21c1
Sequence:CCGGATGGATAAGGGAACCTATATACTCGAGTATATAGGTTCCCTTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004477.2-338s21c1
Sequence:CCGGAGTAACAAACTTTGGTGAAATCTCGAGATTTCACCAAAGTTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004477.2-237s21c1
Sequence:CCGGGGAACCAAGACGAAGAGTAAGCTCGAGCTTACTCTTCGTCTTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004477.2-303s21c1
Sequence:CCGGGAAACCCAGCTTGATATTGTTCTCGAGAACAATATCAAGCTGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004477.2-631s21c1
Sequence:CCGGTGGCTTTGTTGGCCTCAAATACTCGAGTATTTGAGGCCAACAAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004477.1-737s1c1
Sequence:CCGGCTGTGCTGAAAGAGAAACCAACTCGAGTTGGTTTCTCTTTCAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004477.1-768s1c1
Sequence:CCGGGACATTCCAGAAGAAGACAAACTCGAGTTTGTCTTCTTCTGGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004477.1-484s1c1
Sequence:CCGGCGGCTGTCAAATTATCTGATTCTCGAGAATCAGATAATTTGACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks