EMAIL THIS PAGE TO A FRIEND

FRG2

FSHD region gene 2

81 Gene Product Result for
Synonyms: FRG2A
UniProtKB ID: Q64ET8
Gene ID:
Rat(685524) FSHD region gene 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005217 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005217 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005217 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005217 Rosetta Predictions human pricing
XM_001064148 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101665 predicted 1186
2 SASI_Hs01_00101666 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309467 predicted 349
2 SASI_Rn02_00309468 predicted 337
3 SASI_Rn02_00309469 predicted 382
4 SASI_Rn02_00309470 predicted 387
5 SASI_Rn02_00309471 predicted 382
6 SASI_Rn02_00309472 predicted 376
7 SASI_Rn02_00309473 predicted 256
8 SASI_Rn02_00309474 predicted 335
9 SASI_Rn02_00309475 predicted 386
10 SASI_Rn02_00309476 predicted 381
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005217
FRG2 MISSION shRNA Bacterial Glycerol Stock
FSHD region gene 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005217.1-855s1c1
Sequence:CCGGGAGACTGTCAGTGGATCAGATCTCGAGATCTGATCCACTGACAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005217.1-863s1c1
Sequence:CCGGCAGTGGATCAGATGAGGCTAACTCGAGTTAGCCTCATCTGATCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005217.1-151s1c1
Sequence:CCGGGCTCAGATGAGAAGAAACCATCTCGAGATGGTTTCTTCTCATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005217.1-205s1c1
Sequence:CCGGCCAGTGAGAAGCACATACAAACTCGAGTTTGTATGTGCTTCTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005217.1-126s1c1
Sequence:CCGGCAACAGATCTCCTTTACAGAACTCGAGTTCTGTAAAGGAGATCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005217.1-404s1c1
Sequence:CCGGGTGCAGCTTGTCATTGAATAACTCGAGTTATTCAATGACAAGCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005217.1-1032s1c1
Sequence:CCGGGAAAGAAACTTGAGCGGTATACTCGAGTATACCGCTCAAGTTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005217.1-1538s1c1
Sequence:CCGGCGCCTTACCAAGAAATTGCTTCTCGAGAAGCAATTTCTTGGTAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005217.1-603s1c1
Sequence:CCGGGAGGCTGTTTATCAAGACCTACTCGAGTAGGTCTTGATAAACAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138118    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005217.1-1534s1c1
Sequence:CCGGGAGCCGCCTTACCAAGAAATTCTCGAGAATTTCTTGGTAAGGCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005217.1-459s1c1
Sequence:CCGGGAAATCCAGGAGACCTGTGATCTCGAGATCACAGGTCTCCTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005217
FRG2 MISSION shRNA shRNA Plasmid DNA
FSHD region gene 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005217.1-855s1c1
Sequence:CCGGGAGACTGTCAGTGGATCAGATCTCGAGATCTGATCCACTGACAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005217.1-863s1c1
Sequence:CCGGCAGTGGATCAGATGAGGCTAACTCGAGTTAGCCTCATCTGATCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005217.1-151s1c1
Sequence:CCGGGCTCAGATGAGAAGAAACCATCTCGAGATGGTTTCTTCTCATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005217.1-205s1c1
Sequence:CCGGCCAGTGAGAAGCACATACAAACTCGAGTTTGTATGTGCTTCTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005217.1-126s1c1
Sequence:CCGGCAACAGATCTCCTTTACAGAACTCGAGTTCTGTAAAGGAGATCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005217.1-404s1c1
Sequence:CCGGGTGCAGCTTGTCATTGAATAACTCGAGTTATTCAATGACAAGCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005217.1-1032s1c1
Sequence:CCGGGAAAGAAACTTGAGCGGTATACTCGAGTATACCGCTCAAGTTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005217.1-1538s1c1
Sequence:CCGGCGCCTTACCAAGAAATTGCTTCTCGAGAAGCAATTTCTTGGTAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005217.1-603s1c1
Sequence:CCGGGAGGCTGTTTATCAAGACCTACTCGAGTAGGTCTTGATAAACAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138118    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005217.1-1534s1c1
Sequence:CCGGGAGCCGCCTTACCAAGAAATTCTCGAGAATTTCTTGGTAAGGCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005217.1-459s1c1
Sequence:CCGGGAAATCCAGGAGACCTGTGATCTCGAGATCACAGGTCTCCTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005217
FRG2 MISSION shRNA Lentiviral Transduction Particles
FSHD region gene 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005217.1-855s1c1
Sequence:CCGGGAGACTGTCAGTGGATCAGATCTCGAGATCTGATCCACTGACAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005217.1-863s1c1
Sequence:CCGGCAGTGGATCAGATGAGGCTAACTCGAGTTAGCCTCATCTGATCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005217.1-151s1c1
Sequence:CCGGGCTCAGATGAGAAGAAACCATCTCGAGATGGTTTCTTCTCATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005217.1-205s1c1
Sequence:CCGGCCAGTGAGAAGCACATACAAACTCGAGTTTGTATGTGCTTCTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005217.1-126s1c1
Sequence:CCGGCAACAGATCTCCTTTACAGAACTCGAGTTCTGTAAAGGAGATCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005217.1-404s1c1
Sequence:CCGGGTGCAGCTTGTCATTGAATAACTCGAGTTATTCAATGACAAGCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005217.1-1032s1c1
Sequence:CCGGGAAAGAAACTTGAGCGGTATACTCGAGTATACCGCTCAAGTTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005217.1-1538s1c1
Sequence:CCGGCGCCTTACCAAGAAATTGCTTCTCGAGAAGCAATTTCTTGGTAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005217.1-603s1c1
Sequence:CCGGGAGGCTGTTTATCAAGACCTACTCGAGTAGGTCTTGATAAACAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138118    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005217.1-1534s1c1
Sequence:CCGGGAGCCGCCTTACCAAGAAATTCTCGAGAATTTCTTGGTAAGGCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005217.1-459s1c1
Sequence:CCGGGAAATCCAGGAGACCTGTGATCTCGAGATCACAGGTCTCCTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks