EMAIL THIS PAGE TO A FRIEND

FRG2B

FSHD region gene 2 family, member B

Species: Human FRG2B(441581)
UniProtKB ID: Q96QU4, Q5VSQ1
Gene ID:
9 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080998 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080998 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080998 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108171 MISSION® esiRNA esiRNA human FRG2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080998 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316277 predicted 220
2 SASI_Hs02_00316278 predicted 399
3 SASI_Hs02_00316279 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080998
FRG2B MISSION shRNA Bacterial Glycerol Stock
FSHD region gene 2 family, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080998.1-157s21c1
Sequence:CCGGATGAGAAGAAACCATTCAAAGCTCGAGCTTTGAATGGTTTCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080998.1-593s21c1
Sequence:CCGGAGCTATGTCAGAGGCTGTTTACTCGAGTAAACAGCCTCTGACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080998.1-546s21c1
Sequence:CCGGGGAGTCCAAACACCGTCAATTCTCGAGAATTGACGGTGTTTGGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080998.1-403s21c1
Sequence:CCGGAGTGCAGCTTGTCATTGAATACTCGAGTATTCAATGACAAGCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080998.1-443s21c1
Sequence:CCGGTCCTGTGCACAACAGTGAAATCTCGAGATTTCACTGTTGTGCACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080998
FRG2B MISSION shRNA shRNA Plasmid DNA
FSHD region gene 2 family, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080998.1-157s21c1
Sequence:CCGGATGAGAAGAAACCATTCAAAGCTCGAGCTTTGAATGGTTTCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080998.1-593s21c1
Sequence:CCGGAGCTATGTCAGAGGCTGTTTACTCGAGTAAACAGCCTCTGACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080998.1-546s21c1
Sequence:CCGGGGAGTCCAAACACCGTCAATTCTCGAGAATTGACGGTGTTTGGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080998.1-403s21c1
Sequence:CCGGAGTGCAGCTTGTCATTGAATACTCGAGTATTCAATGACAAGCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080998.1-443s21c1
Sequence:CCGGTCCTGTGCACAACAGTGAAATCTCGAGATTTCACTGTTGTGCACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080998
FRG2B MISSION shRNA Lentiviral Transduction Particles
FSHD region gene 2 family, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080998.1-157s21c1
Sequence:CCGGATGAGAAGAAACCATTCAAAGCTCGAGCTTTGAATGGTTTCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080998.1-593s21c1
Sequence:CCGGAGCTATGTCAGAGGCTGTTTACTCGAGTAAACAGCCTCTGACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080998.1-546s21c1
Sequence:CCGGGGAGTCCAAACACCGTCAATTCTCGAGAATTGACGGTGTTTGGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080998.1-403s21c1
Sequence:CCGGAGTGCAGCTTGTCATTGAATACTCGAGTATTCAATGACAAGCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080998.1-443s21c1
Sequence:CCGGTCCTGTGCACAACAGTGAAATCTCGAGATTTCACTGTTGTGCACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks