EMAIL THIS PAGE TO A FRIEND

FRK

fyn-related kinase

158 Gene Product Result for
Synonyms: GTK PTK5 RAK
UniProtKB ID: P42685, Q13128, Q9NTR5
Gene ID:
Human(2444) Summary: The protein encoded by this gene belongs to the TYR family of protein kinases. This tyrosine kinase is a nuclear protein and may function during G1 and S phase of the cell cycle and suppress growth. [provided by RefSeq, Jul 2008]
Mouse(14302) fyn-related kinase
Rat(79209) fyn-related kinase
domestic cat(101088668) fyn-related kinase
cow(509227) fyn-related kinase
dog(481970) fyn-related kinase
chicken(421747) fyn-related kinase
domestic guinea pig(100726734) fyn-related kinase
sheep(101106946) fyn-related kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
F7556 Anti-FRK (221-235) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
F7681 Anti-FRK (491-505) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1300419 Anti-FRK (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1405829 Anti-FRK antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2100857 Anti-FRK antibody produced in rabbit affinity isolated antibody mouse, rat, guinea pig, bovine, human, horse, rabbit
western blot pricing
SAB4501037 Anti-FRK antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA057484 Anti-FRK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB2103361 Anti-FRK, (N-terminal) antibody produced in rabbit affinity isolated antibody bovine, guinea pig, mouse, rat, human, horse
western blot pricing
SAB1302588 ANTI-MOUSE FRK (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB5300095 Monoclonal Anti-FRK antibody produced in mouse clone 1A8H2C12, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB5300096 Monoclonal Anti-FRK antibody produced in mouse clone 4E1, ascites fluid human
ELISA, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0964 Phosphotyrosine FRK / Tyrosine-protein Kinase FRK ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002031 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002031 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002031 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010237 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010237 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010237 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002031 Rosetta Predictions human pricing
NM_024368 Rosetta Predictions rat pricing
XM_579487 Rosetta Predictions rat pricing
NM_010237 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226769 predicted 1916
2 SASI_Hs01_00226771 predicted 2043
3 SASI_Hs01_00226772 predicted 727
4 SASI_Hs01_00226773 predicted 1277
5 SASI_Hs01_00226774 predicted 635
6 SASI_Hs01_00226775 predicted 1090
7 SASI_Hs01_00226776 predicted 1599
8 SASI_Hs01_00226777 predicted 1852
9 SASI_Hs01_00226778 predicted 1245
10 SASI_Hs02_00333054 predicted 1656
11 SASI_Hs01_00226770 predicted 1340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024368 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081837 predicted 1332
2 SASI_Rn01_00081838 predicted 730
3 SASI_Rn02_00263955 predicted 1588
4 SASI_Rn01_00081839 predicted 1809
5 SASI_Rn01_00081840 predicted 1816
6 SASI_Rn01_00081841 predicted 1603
7 SASI_Rn01_00081842 predicted 448
8 SASI_Rn01_00081843 predicted 1659
9 SASI_Rn02_00263956 predicted 1699
10 SASI_Rn01_00081844 predicted 1279
11 SASI_Rn01_00081835 predicted 2009
12 SASI_Rn01_00081836 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172535 predicted 437
2 SASI_Rn01_00172536 predicted 421
3 SASI_Rn01_00172537 predicted 518
4 SASI_Rn01_00172538 predicted 463
5 SASI_Rn01_00172539 predicted 473
6 SASI_Rn01_00172540 predicted 370
7 SASI_Rn01_00172541 predicted 424
8 SASI_Rn01_00172542 predicted 430
9 SASI_Rn01_00172543 predicted 1101
10 SASI_Rn01_00172544 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010237 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318097 predicted 1631
2 SASI_Mm01_00164565 predicted 1366
3 SASI_Mm01_00164566 predicted 770
4 SASI_Mm01_00164567 predicted 1948
5 SASI_Mm01_00164568 predicted 527
6 SASI_Mm01_00164569 predicted 1642
7 SASI_Mm01_00164570 predicted 1358
8 SASI_Mm01_00164572 predicted 1699
9 SASI_Mm01_00164573 predicted 1041
10 SASI_Mm02_00318098 predicted 1797
11 SASI_Mm01_00164571 predicted 1515
12 SASI_Mm01_00164574 predicted 1740
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002031
VALIDATED
FRK MISSION shRNA Bacterial Glycerol Stock
fyn-related kinase
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002031.2-2195s21c1
Sequence:CCGGAGCACACTAAACCAAGTTATTCTCGAGAATAACTTGGTTTAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002031.2-2499s1c1
Sequence:CCGGTGATTGTACTTGGAGTAATTGCTCGAGCAATTACTCCAAGTACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002031.2-728s1c1
Sequence:CCGGAGCAACTACAAGGCTATATTCCTCGAGGAATATAGCCTTGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002031.2-2499s21c1
Sequence:CCGGTGATTGTACTTGGAGTAATTGCTCGAGCAATTACTCCAAGTACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002031.2-1651s21c1
Sequence:CCGGCCCGAAGCCATTCGTAGTAATCTCGAGATTACTACGAATGGCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002031.2-1608s21c1
Sequence:CCGGTGAATCTAGACACGAAATAAACTCGAGTTTATTTCGTGTCTAGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002031.2-1093s21c1
Sequence:CCGGCCATTTGATTTGTCGTATAAACTCGAGTTTATACGACAAATCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_002031.2-728s21c1
Sequence:CCGGAGCAACTACAAGGCTATATTCCTCGAGGAATATAGCCTTGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002031.2-1527s21c1
Sequence:CCGGCCTCGTTGGTGAACATAATATCTCGAGATATTATGTTCACCAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002031.2-2148s21c1
Sequence:CCGGAGGACAGTCAAGGTGATATATCTCGAGATATATCACCTTGACTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002031.x-789s1c1
Sequence:CCGGGCCGTGGTTCTTTGGAGCAATCTCGAGATTGCTCCAAAGAACCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002031.x-1090s1c1
Sequence:CCGGGCTCCATTTGATTTGTCGTATCTCGAGATACGACAAATCAAATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002031.x-1620s1c1
Sequence:CCGGCGAAATAAAGCTGCCGGTGAACTCGAGTTCACCGGCAGCTTTATTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_002031.x-1177s1c1
Sequence:CCGGCAGTTTGGCGAAGTATGGGAACTCGAGTTCCCATACTTCGCCAAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002031.2-1243s1c1
Sequence:CCGGCCAGGTTCAATGGATCCAAATCTCGAGATTTGGATCCATTGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002031.2-1867s1c1
Sequence:CCGGCCTAAGGAACGACCTACATTTCTCGAGAAATGTAGGTCGTTCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002031.2-2063s1c1
Sequence:CCGGCCTGACATATTCAAGTGATAGCTCGAGCTATCACTTGAATATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002031
VALIDATED
FRK MISSION shRNA shRNA Plasmid DNA
fyn-related kinase
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002031.2-2195s21c1
Sequence:CCGGAGCACACTAAACCAAGTTATTCTCGAGAATAACTTGGTTTAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002031.2-2499s1c1
Sequence:CCGGTGATTGTACTTGGAGTAATTGCTCGAGCAATTACTCCAAGTACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002031.2-728s1c1
Sequence:CCGGAGCAACTACAAGGCTATATTCCTCGAGGAATATAGCCTTGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002031.2-2499s21c1
Sequence:CCGGTGATTGTACTTGGAGTAATTGCTCGAGCAATTACTCCAAGTACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002031.2-1651s21c1
Sequence:CCGGCCCGAAGCCATTCGTAGTAATCTCGAGATTACTACGAATGGCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002031.2-1608s21c1
Sequence:CCGGTGAATCTAGACACGAAATAAACTCGAGTTTATTTCGTGTCTAGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002031.2-1093s21c1
Sequence:CCGGCCATTTGATTTGTCGTATAAACTCGAGTTTATACGACAAATCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_002031.2-728s21c1
Sequence:CCGGAGCAACTACAAGGCTATATTCCTCGAGGAATATAGCCTTGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002031.2-1527s21c1
Sequence:CCGGCCTCGTTGGTGAACATAATATCTCGAGATATTATGTTCACCAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002031.2-2148s21c1
Sequence:CCGGAGGACAGTCAAGGTGATATATCTCGAGATATATCACCTTGACTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002031.x-789s1c1
Sequence:CCGGGCCGTGGTTCTTTGGAGCAATCTCGAGATTGCTCCAAAGAACCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002031.x-1090s1c1
Sequence:CCGGGCTCCATTTGATTTGTCGTATCTCGAGATACGACAAATCAAATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002031.x-1620s1c1
Sequence:CCGGCGAAATAAAGCTGCCGGTGAACTCGAGTTCACCGGCAGCTTTATTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_002031.x-1177s1c1
Sequence:CCGGCAGTTTGGCGAAGTATGGGAACTCGAGTTCCCATACTTCGCCAAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002031.2-1243s1c1
Sequence:CCGGCCAGGTTCAATGGATCCAAATCTCGAGATTTGGATCCATTGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002031.2-1867s1c1
Sequence:CCGGCCTAAGGAACGACCTACATTTCTCGAGAAATGTAGGTCGTTCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002031.2-2063s1c1
Sequence:CCGGCCTGACATATTCAAGTGATAGCTCGAGCTATCACTTGAATATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002031
VALIDATED
FRK MISSION shRNA Lentiviral Transduction Particles
fyn-related kinase
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002031.2-2195s21c1
Sequence:CCGGAGCACACTAAACCAAGTTATTCTCGAGAATAACTTGGTTTAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002031.2-2499s1c1
Sequence:CCGGTGATTGTACTTGGAGTAATTGCTCGAGCAATTACTCCAAGTACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002031.2-728s1c1
Sequence:CCGGAGCAACTACAAGGCTATATTCCTCGAGGAATATAGCCTTGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002031.2-2499s21c1
Sequence:CCGGTGATTGTACTTGGAGTAATTGCTCGAGCAATTACTCCAAGTACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002031.2-1651s21c1
Sequence:CCGGCCCGAAGCCATTCGTAGTAATCTCGAGATTACTACGAATGGCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002031.2-1608s21c1
Sequence:CCGGTGAATCTAGACACGAAATAAACTCGAGTTTATTTCGTGTCTAGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002031.2-1093s21c1
Sequence:CCGGCCATTTGATTTGTCGTATAAACTCGAGTTTATACGACAAATCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_002031.2-728s21c1
Sequence:CCGGAGCAACTACAAGGCTATATTCCTCGAGGAATATAGCCTTGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002031.2-1527s21c1
Sequence:CCGGCCTCGTTGGTGAACATAATATCTCGAGATATTATGTTCACCAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002031.2-2148s21c1
Sequence:CCGGAGGACAGTCAAGGTGATATATCTCGAGATATATCACCTTGACTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002031.x-789s1c1
Sequence:CCGGGCCGTGGTTCTTTGGAGCAATCTCGAGATTGCTCCAAAGAACCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002031.x-1090s1c1
Sequence:CCGGGCTCCATTTGATTTGTCGTATCTCGAGATACGACAAATCAAATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002031.x-1620s1c1
Sequence:CCGGCGAAATAAAGCTGCCGGTGAACTCGAGTTCACCGGCAGCTTTATTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_002031.x-1177s1c1
Sequence:CCGGCAGTTTGGCGAAGTATGGGAACTCGAGTTCCCATACTTCGCCAAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002031.2-1243s1c1
Sequence:CCGGCCAGGTTCAATGGATCCAAATCTCGAGATTTGGATCCATTGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002031.2-1867s1c1
Sequence:CCGGCCTAAGGAACGACCTACATTTCTCGAGAAATGTAGGTCGTTCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002031.2-2063s1c1
Sequence:CCGGCCTGACATATTCAAGTGATAGCTCGAGCTATCACTTGAATATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010237
VALIDATED
FRK MISSION shRNA Bacterial Glycerol Stock
fyn-related kinase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010237.2-1791s21c1
Sequence:CCGGTATGACAGGTGCTCAAGTAATCTCGAGATTACTTGAGCACCTGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010237.2-1248s21c1
Sequence:CCGGTACCACTCCAGTGGCCGTAAACTCGAGTTTACGGCCACTGGAGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010237.2-1370s21c1
Sequence:CCGGGCACTTTAGAAGATCCCATTTCTCGAGAAATGGGATCTTCTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010237.2-1915s21c1
Sequence:CCGGCCAACATTTGAGACCCTGCATCTCGAGATGCAGGGTCTCAAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010237.2-2368s21c1
Sequence:CCGGTACTAATTAGACTGGTTATTCCTCGAGGAATAACCAGTCTAATTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010237.2-1915s1c1
Sequence:CCGGCCAACATTTGAGACCCTGCATCTCGAGATGCAGGGTCTCAAATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010237.2-1857s1c1
Sequence:CCGGCCCACAGCAATTCTACAGCATCTCGAGATGCTGTAGAATTGCTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010237.2-1038s1c1
Sequence:CCGGCCTGAATGAATTCGTGAACTACTCGAGTAGTTCACGAATTCATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010237.2-1688s1c1
Sequence:CCGGCCGAAGCCATTCGTACTAATACTCGAGTATTAGTACGAATGGCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010237
VALIDATED
FRK MISSION shRNA shRNA Plasmid DNA
fyn-related kinase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010237.2-1791s21c1
Sequence:CCGGTATGACAGGTGCTCAAGTAATCTCGAGATTACTTGAGCACCTGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010237.2-1248s21c1
Sequence:CCGGTACCACTCCAGTGGCCGTAAACTCGAGTTTACGGCCACTGGAGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010237.2-1370s21c1
Sequence:CCGGGCACTTTAGAAGATCCCATTTCTCGAGAAATGGGATCTTCTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010237.2-1915s21c1
Sequence:CCGGCCAACATTTGAGACCCTGCATCTCGAGATGCAGGGTCTCAAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010237.2-2368s21c1
Sequence:CCGGTACTAATTAGACTGGTTATTCCTCGAGGAATAACCAGTCTAATTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010237.2-1915s1c1
Sequence:CCGGCCAACATTTGAGACCCTGCATCTCGAGATGCAGGGTCTCAAATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010237.2-1857s1c1
Sequence:CCGGCCCACAGCAATTCTACAGCATCTCGAGATGCTGTAGAATTGCTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010237.2-1038s1c1
Sequence:CCGGCCTGAATGAATTCGTGAACTACTCGAGTAGTTCACGAATTCATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010237.2-1688s1c1
Sequence:CCGGCCGAAGCCATTCGTACTAATACTCGAGTATTAGTACGAATGGCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010237
VALIDATED
FRK MISSION shRNA Lentiviral Transduction Particles
fyn-related kinase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010237.2-1791s21c1
Sequence:CCGGTATGACAGGTGCTCAAGTAATCTCGAGATTACTTGAGCACCTGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010237.2-1248s21c1
Sequence:CCGGTACCACTCCAGTGGCCGTAAACTCGAGTTTACGGCCACTGGAGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010237.2-1370s21c1
Sequence:CCGGGCACTTTAGAAGATCCCATTTCTCGAGAAATGGGATCTTCTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010237.2-1915s21c1
Sequence:CCGGCCAACATTTGAGACCCTGCATCTCGAGATGCAGGGTCTCAAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010237.2-2368s21c1
Sequence:CCGGTACTAATTAGACTGGTTATTCCTCGAGGAATAACCAGTCTAATTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010237.2-1915s1c1
Sequence:CCGGCCAACATTTGAGACCCTGCATCTCGAGATGCAGGGTCTCAAATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010237.2-1857s1c1
Sequence:CCGGCCCACAGCAATTCTACAGCATCTCGAGATGCTGTAGAATTGCTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010237.2-1038s1c1
Sequence:CCGGCCTGAATGAATTCGTGAACTACTCGAGTAGTTCACGAATTCATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010237.2-1688s1c1
Sequence:CCGGCCGAAGCCATTCGTACTAATACTCGAGTATTAGTACGAATGGCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks