EMAIL THIS PAGE TO A FRIEND

FRMD1

FERM domain containing 1

45 Gene Product Result for
Synonyms: bA164L23.1
UniProtKB ID: Q8N878, B2RNV8, B3KUM6, Q5SZU7, Q9UFB0
Gene ID:
Rat(689709) FERM domain containing 1
chicken(421562) FERM domain containing 1
dog(484086) FERM domain containing 1
domestic cat(101081897) FERM domain containing 1
cow(616869) FERM domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024919 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068581 MISSION® esiRNA esiRNA human FRMD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122841 Rosetta Predictions human pricing
NM_024919 Rosetta Predictions human pricing
XM_001071738 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327477 predicted 950
2 SASI_Hs02_00327478 predicted 1100
3 SASI_Hs02_00327479 predicted 1772
4 SASI_Hs02_00327480 predicted 1812
5 SASI_Hs02_00327481 predicted 1915
6 SASI_Hs02_00327482 predicted 1799
7 SASI_Hs02_00327483 predicted 509
8 SASI_Hs02_00327484 predicted 1912
9 SASI_Hs02_00327485 predicted 381
10 SASI_Hs02_00327486 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162163 predicted 1115
2 SASI_Hs02_00357531 predicted 1264
3 SASI_Hs01_00162164 predicted 1928
4 SASI_Hs01_00162165 predicted 1973
5 SASI_Hs02_00357532 predicted 2083
6 SASI_Hs02_00357533 predicted 1962
7 SASI_Hs02_00357534 predicted 666
8 SASI_Hs01_00162168 predicted 2071
9 SASI_Hs01_00162169 predicted 536
10 SASI_Hs02_00357535 predicted 876
11 SASI_Hs01_00162160 predicted 284
12 SASI_Hs01_00162161 predicted 217
13 SASI_Hs01_00162162 predicted 976
14 SASI_Hs01_00162166 predicted 936
15 SASI_Hs01_00162167 predicted 1858
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336256 predicted 905
2 SASI_Rn02_00336257 predicted 288
3 SASI_Rn02_00336258 predicted 499
4 SASI_Rn02_00336259 predicted 730
5 SASI_Rn02_00336260 predicted 445
6 SASI_Rn02_00336261 predicted 523
7 SASI_Rn02_00336262 predicted 749
8 SASI_Rn02_00336263 predicted 1048
9 SASI_Rn02_00336264 predicted 830
10 SASI_Rn02_00336265 predicted 270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024919
FRMD1 MISSION shRNA Bacterial Glycerol Stock
FERM domain containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024919.2-360s1c1
Sequence:CCGGGTGGTCAGAAACAATGAGTATCTCGAGATACTCATTGTTTCTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024919.2-545s1c1
Sequence:CCGGCCTGTACTACTGCCACTTGAACTCGAGTTCAAGTGGCAGTAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024919.2-2160s1c1
Sequence:CCGGGCCGGAGTTCACAGTTATCATCTCGAGATGATAACTGTGAACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024919.2-359s1c1
Sequence:CCGGTGTGGTCAGAAACAATGAGTACTCGAGTACTCATTGTTTCTGACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024919.3-490s21c1
Sequence:GTACCGGGAGTGCAGCACTACGTGGAAACTCGAGTTTCCACGTAGTGCTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024919.3-684s21c1
Sequence:GTACCGGTTCGAGCCACACTCCTACTTCCTCGAGGAAGTAGGAGTGTGGCTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024919.3-1878s21c1
Sequence:GTACCGGCATCAACCTGGGAGGTAACAACTCGAGTTGTTACCTCCCAGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024919.3-971s21c1
Sequence:GTACCGGCGCAGCACAGAAGCTGGTTTACTCGAGTAAACCAGCTTCTGTGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024919.3-1118s21c1
Sequence:GTACCGGGCACTACCGGGAGTCCTATATCTCGAGATATAGGACTCCCGGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024919.3-331s21c1
Sequence:GTACCGGTCAGAGACGCGCAGTTCTTTGCTCGAGCAAAGAACTGCGCGTCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024919.3-2023s21c1
Sequence:GTACCGGAGCCTGTCACCCATCCTAATCCTCGAGGATTAGGATGGGTGACAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024919
FRMD1 MISSION shRNA shRNA Plasmid DNA
FERM domain containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024919.2-360s1c1
Sequence:CCGGGTGGTCAGAAACAATGAGTATCTCGAGATACTCATTGTTTCTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024919.2-545s1c1
Sequence:CCGGCCTGTACTACTGCCACTTGAACTCGAGTTCAAGTGGCAGTAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024919.2-2160s1c1
Sequence:CCGGGCCGGAGTTCACAGTTATCATCTCGAGATGATAACTGTGAACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024919.2-359s1c1
Sequence:CCGGTGTGGTCAGAAACAATGAGTACTCGAGTACTCATTGTTTCTGACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024919.3-490s21c1
Sequence:GTACCGGGAGTGCAGCACTACGTGGAAACTCGAGTTTCCACGTAGTGCTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024919.3-684s21c1
Sequence:GTACCGGTTCGAGCCACACTCCTACTTCCTCGAGGAAGTAGGAGTGTGGCTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024919.3-1878s21c1
Sequence:GTACCGGCATCAACCTGGGAGGTAACAACTCGAGTTGTTACCTCCCAGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024919.3-971s21c1
Sequence:GTACCGGCGCAGCACAGAAGCTGGTTTACTCGAGTAAACCAGCTTCTGTGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024919.3-1118s21c1
Sequence:GTACCGGGCACTACCGGGAGTCCTATATCTCGAGATATAGGACTCCCGGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024919.3-331s21c1
Sequence:GTACCGGTCAGAGACGCGCAGTTCTTTGCTCGAGCAAAGAACTGCGCGTCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024919.3-2023s21c1
Sequence:GTACCGGAGCCTGTCACCCATCCTAATCCTCGAGGATTAGGATGGGTGACAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024919
FRMD1 MISSION shRNA Lentiviral Transduction Particles
FERM domain containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024919.2-360s1c1
Sequence:CCGGGTGGTCAGAAACAATGAGTATCTCGAGATACTCATTGTTTCTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024919.2-545s1c1
Sequence:CCGGCCTGTACTACTGCCACTTGAACTCGAGTTCAAGTGGCAGTAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024919.2-2160s1c1
Sequence:CCGGGCCGGAGTTCACAGTTATCATCTCGAGATGATAACTGTGAACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024919.2-359s1c1
Sequence:CCGGTGTGGTCAGAAACAATGAGTACTCGAGTACTCATTGTTTCTGACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024919.3-490s21c1
Sequence:GTACCGGGAGTGCAGCACTACGTGGAAACTCGAGTTTCCACGTAGTGCTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024919.3-684s21c1
Sequence:GTACCGGTTCGAGCCACACTCCTACTTCCTCGAGGAAGTAGGAGTGTGGCTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024919.3-1878s21c1
Sequence:GTACCGGCATCAACCTGGGAGGTAACAACTCGAGTTGTTACCTCCCAGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024919.3-971s21c1
Sequence:GTACCGGCGCAGCACAGAAGCTGGTTTACTCGAGTAAACCAGCTTCTGTGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024919.3-1118s21c1
Sequence:GTACCGGGCACTACCGGGAGTCCTATATCTCGAGATATAGGACTCCCGGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024919.3-331s21c1
Sequence:GTACCGGTCAGAGACGCGCAGTTCTTTGCTCGAGCAAAGAACTGCGCGTCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024919.3-2023s21c1
Sequence:GTACCGGAGCCTGTCACCCATCCTAATCCTCGAGGATTAGGATGGGTGACAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks