EMAIL THIS PAGE TO A FRIEND

FRMD3

FERM domain containing 3

107 Gene Product Result for
Synonyms: 4.1O EPB41L4O EPB41LO P410
Gene ID:
Human(257019) Summary: The protein encoded by this gene is a single pass membrane protein primarily found in ovaries. A similar protein in erythrocytes helps determine the shape of red blood cells, but the function of the encoded protein has not been determined. There is some evidence that this is a tumor suppressor gene, and there is also evidence linking defects in this gene to susceptibility to diabetic nephropathy in type 1 diabetes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(242506) FERM domain containing 3
Rat(298141) FERM domain containing 3
domestic guinea pig(100726134) FERM domain containing 3
naked mole-rat(101710758) FERM domain containing 3
sheep(101119441) FERM domain containing 3
chicken(427452) FERM domain containing 3
cow(533321) FERM domain containing 3
Horse(100054067) FERM domain containing 3
domestic cat(101098662) FERM domain containing 3
dog(484151) FERM domain containing 3
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174938 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172869 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172869 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172869 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174938 Rosetta Predictions human pricing
NM_001106662 Rosetta Predictions rat pricing
XM_216427 Rosetta Predictions rat pricing
NM_172869 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207623 predicted 1640
2 SASI_Hs02_00368877 predicted 2019
3 SASI_Hs01_00207625 predicted 2077
4 SASI_Hs02_00368878 predicted 1850
5 SASI_Hs01_00207626 predicted 496
6 SASI_Hs01_00207627 predicted 1525
7 SASI_Hs02_00368879 predicted 1736
8 SASI_Hs01_00207629 predicted 653
9 SASI_Hs01_00207630 predicted 2014
10 SASI_Hs01_00207632 predicted 2053
11 SASI_Hs01_00207624 predicted 1145
12 SASI_Hs01_00207628 predicted 1903
13 SASI_Hs01_00207631 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106662 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221158 predicted 931
2 SASI_Rn02_00221159 predicted 616
3 SASI_Rn02_00221160 predicted 782
4 SASI_Rn02_00221161 predicted 1085
5 SASI_Rn02_00221162 predicted 968
6 SASI_Rn02_00221163 predicted 486
7 SASI_Rn02_00221164 predicted 519
8 SASI_Rn02_00221165 predicted 1403
9 SASI_Rn02_00221166 predicted 632
10 SASI_Rn02_00221167 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216427 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142191 predicted 1122
2 SASI_Rn01_00142192 predicted 945
3 SASI_Rn01_00142193 predicted 638
4 SASI_Rn01_00142194 predicted 805
5 SASI_Rn01_00142195 predicted 523
6 SASI_Rn01_00142196 predicted 982
7 SASI_Rn01_00142197 predicted 509
8 SASI_Rn01_00142198 predicted 543
9 SASI_Rn01_00142199 predicted 791
10 SASI_Rn01_00142200 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063943 predicted 801
2 SASI_Mm01_00063944 predicted 370
3 SASI_Mm02_00344840 predicted 1863
4 SASI_Mm01_00063945 predicted 245
5 SASI_Mm01_00063946 predicted 539
6 SASI_Mm01_00063947 predicted 1765
7 SASI_Mm01_00063948 predicted 640
8 SASI_Mm01_00063949 predicted 1782
9 SASI_Mm01_00063950 predicted 1133
10 SASI_Mm01_00063951 predicted 1458
11 SASI_Mm01_00063942 predicted 731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174938
FRMD3 MISSION shRNA Bacterial Glycerol Stock
FERM domain containing 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174938.4-1157s21c1
Sequence:CCGGGTATCAAGCAGCAAGATATTTCTCGAGAAATATCTTGCTGCTTGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174938.4-261s21c1
Sequence:CCGGTTCGGAGCTCCAGCGTCAAATCTCGAGATTTGACGCTGGAGCTCCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174938.3-2087s1c1
Sequence:CCGGGCTGTCAACAGGTGTTCCTTACTCGAGTAAGGAACACCTGTTGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174938.3-2025s1c1
Sequence:CCGGGCTATATTCAATGCTAGTGATCTCGAGATCACTAGCATTGAATATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174938.3-984s1c1
Sequence:CCGGGATGTCTGCAAATTGAAGTTTCTCGAGAAACTTCAATTTGCAGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174938.3-980s1c1
Sequence:CCGGGCCAGATGTCTGCAAATTGAACTCGAGTTCAATTTGCAGACATCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160110    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174938.3-2144s1c1
Sequence:CCGGCCATAATTCACTGCACTTAAACTCGAGTTTAAGTGCAGTGAATTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174938.3-2128s1c1
Sequence:CCGGCCTTTAAGTTAGCTTTCCATACTCGAGTATGGAAAGCTAACTTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174938.3-464s1c1
Sequence:CCGGGCTTGAACCTAACAAGTCCATCTCGAGATGGACTTGTTAGGTTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174938
FRMD3 MISSION shRNA shRNA Plasmid DNA
FERM domain containing 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174938.4-1157s21c1
Sequence:CCGGGTATCAAGCAGCAAGATATTTCTCGAGAAATATCTTGCTGCTTGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174938.4-261s21c1
Sequence:CCGGTTCGGAGCTCCAGCGTCAAATCTCGAGATTTGACGCTGGAGCTCCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174938.3-2087s1c1
Sequence:CCGGGCTGTCAACAGGTGTTCCTTACTCGAGTAAGGAACACCTGTTGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174938.3-2025s1c1
Sequence:CCGGGCTATATTCAATGCTAGTGATCTCGAGATCACTAGCATTGAATATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174938.3-984s1c1
Sequence:CCGGGATGTCTGCAAATTGAAGTTTCTCGAGAAACTTCAATTTGCAGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174938.3-980s1c1
Sequence:CCGGGCCAGATGTCTGCAAATTGAACTCGAGTTCAATTTGCAGACATCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160110    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174938.3-2144s1c1
Sequence:CCGGCCATAATTCACTGCACTTAAACTCGAGTTTAAGTGCAGTGAATTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174938.3-2128s1c1
Sequence:CCGGCCTTTAAGTTAGCTTTCCATACTCGAGTATGGAAAGCTAACTTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174938.3-464s1c1
Sequence:CCGGGCTTGAACCTAACAAGTCCATCTCGAGATGGACTTGTTAGGTTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174938
FRMD3 MISSION shRNA Lentiviral Transduction Particles
FERM domain containing 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174938.4-1157s21c1
Sequence:CCGGGTATCAAGCAGCAAGATATTTCTCGAGAAATATCTTGCTGCTTGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174938.4-261s21c1
Sequence:CCGGTTCGGAGCTCCAGCGTCAAATCTCGAGATTTGACGCTGGAGCTCCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174938.3-2087s1c1
Sequence:CCGGGCTGTCAACAGGTGTTCCTTACTCGAGTAAGGAACACCTGTTGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174938.3-2025s1c1
Sequence:CCGGGCTATATTCAATGCTAGTGATCTCGAGATCACTAGCATTGAATATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174938.3-984s1c1
Sequence:CCGGGATGTCTGCAAATTGAAGTTTCTCGAGAAACTTCAATTTGCAGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174938.3-980s1c1
Sequence:CCGGGCCAGATGTCTGCAAATTGAACTCGAGTTCAATTTGCAGACATCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160110    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174938.3-2144s1c1
Sequence:CCGGCCATAATTCACTGCACTTAAACTCGAGTTTAAGTGCAGTGAATTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174938.3-2128s1c1
Sequence:CCGGCCTTTAAGTTAGCTTTCCATACTCGAGTATGGAAAGCTAACTTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174938.3-464s1c1
Sequence:CCGGGCTTGAACCTAACAAGTCCATCTCGAGATGGACTTGTTAGGTTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172869
FRMD3 MISSION shRNA Bacterial Glycerol Stock
FERM domain containing 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172869.1-2867s1c1
Sequence:CCGGGCTAAGCATGTGGTTGCCTTTCTCGAGAAAGGCAACCACATGCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172869.1-891s1c1
Sequence:CCGGGTCTGCAAATTGAAGTTTGAACTCGAGTTCAAACTTCAATTTGCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172869.1-842s1c1
Sequence:CCGGCGTCGTATTCCAGGGAAATAACTCGAGTTATTTCCCTGGAATACGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172869.1-750s1c1
Sequence:CCGGGCTCATACATTGGAAACTTATCTCGAGATAAGTTTCCAATGTATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172869
FRMD3 MISSION shRNA shRNA Plasmid DNA
FERM domain containing 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172869.1-2867s1c1
Sequence:CCGGGCTAAGCATGTGGTTGCCTTTCTCGAGAAAGGCAACCACATGCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172869.1-891s1c1
Sequence:CCGGGTCTGCAAATTGAAGTTTGAACTCGAGTTCAAACTTCAATTTGCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172869.1-842s1c1
Sequence:CCGGCGTCGTATTCCAGGGAAATAACTCGAGTTATTTCCCTGGAATACGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172869.1-750s1c1
Sequence:CCGGGCTCATACATTGGAAACTTATCTCGAGATAAGTTTCCAATGTATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172869
FRMD3 MISSION shRNA Lentiviral Transduction Particles
FERM domain containing 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172869.1-2867s1c1
Sequence:CCGGGCTAAGCATGTGGTTGCCTTTCTCGAGAAAGGCAACCACATGCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172869.1-891s1c1
Sequence:CCGGGTCTGCAAATTGAAGTTTGAACTCGAGTTCAAACTTCAATTTGCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172869.1-842s1c1
Sequence:CCGGCGTCGTATTCCAGGGAAATAACTCGAGTTATTTCCCTGGAATACGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172869.1-750s1c1
Sequence:CCGGGCTCATACATTGGAAACTTATCTCGAGATAAGTTTCCAATGTATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)