EMAIL THIS PAGE TO A FRIEND

FRMD4A

FERM domain containing 4A

63 Gene Product Result for
Synonyms: FRMD4 bA295P9.4
UniProtKB ID: Q9P2Q2, A7E2Y3, Q5T377
Gene ID:
Mouse(209630) FERM domain containing 4A
Rat(307128) FERM domain containing 4A
dog(607414) FERM domain containing 4A
domestic cat(101098722) FERM domain containing 4A
cow(510714) FERM domain containing 4A
Horse(100056511) FERM domain containing 4A
sheep(101115892) FERM domain containing 4A
naked mole-rat(101703443) FERM domain containing 4A
domestic guinea pig(100727665) FERM domain containing 4A
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038449 Anti-FRMD4A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172475 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172475 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172475 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018027 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018027 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018027 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018027 Rosetta Predictions human pricing
XM_001071750 Rosetta Predictions rat pricing
XM_240734 Rosetta Predictions rat pricing
NM_172475 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017514 predicted 2191
2 SASI_Hs02_00351128 predicted 1949
3 SASI_Hs01_00017516 predicted 593
4 SASI_Hs01_00017517 predicted 1071
5 SASI_Hs02_00351129 predicted 1934
6 SASI_Hs01_00017518 predicted 3473
7 SASI_Hs01_00017519 predicted 1236
8 SASI_Hs01_00017520 predicted 2007
9 SASI_Hs01_00017521 predicted 520
10 SASI_Hs01_00017522 predicted 2295
11 SASI_Hs01_00017515 predicted 2006
12 SASI_Hs01_00017523 predicted 2147
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336319 predicted 2521
2 SASI_Rn02_00336320 predicted 251
3 SASI_Rn02_00336321 predicted 1574
4 SASI_Rn02_00336322 predicted 758
5 SASI_Rn02_00336323 predicted 408
6 SASI_Rn02_00336324 predicted 1837
7 SASI_Rn02_00336325 predicted 802
8 SASI_Rn02_00336326 predicted 1704
9 SASI_Rn02_00336327 predicted 1299
10 SASI_Rn02_00336328 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_240734 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391629 predicted 2292
2 SASI_Rn02_00391630 predicted 2628
3 SASI_Rn02_00391631 predicted 2524
4 SASI_Rn02_00391632 predicted 2622
5 SASI_Rn02_00391633 predicted 2709
6 SASI_Rn02_00391634 predicted 2881
7 SASI_Rn02_00391635 predicted 2321
8 SASI_Rn02_00391636 predicted 2615
9 SASI_Rn02_00391637 predicted 2612
10 SASI_Rn02_00391638 predicted 2540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132132 predicted 960
2 SASI_Mm02_00344028 predicted 968
3 SASI_Mm01_00132133 predicted 1672
4 SASI_Mm01_00132134 predicted 2681
5 SASI_Mm01_00132135 predicted 602
6 SASI_Mm01_00132136 predicted 1079
7 SASI_Mm01_00132137 predicted 1422
8 SASI_Mm01_00132138 predicted 293
9 SASI_Mm01_00132139 predicted 363
10 SASI_Mm01_00132140 predicted 909
11 SASI_Mm01_00132141 predicted 1999
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172475
FRMD4A MISSION shRNA Bacterial Glycerol Stock
FERM domain containing 4A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172475.2-1514s1c1
Sequence:CCGGGAGAATTGGAACAGCCTTCAACTCGAGTTGAAGGCTGTTCCAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172475.2-2239s1c1
Sequence:CCGGCCCACTATGTTCATTCCACAACTCGAGTTGTGGAATGAACATAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172475.2-846s1c1
Sequence:CCGGGTTCACTATTATGCAGTGAAACTCGAGTTTCACTGCATAATAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172475.2-482s1c1
Sequence:CCGGCTTCTGTGTCAGATTCTACATCTCGAGATGTAGAATCTGACACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172475.2-3645s1c1
Sequence:CCGGCCTGTAGAAGAGAACAAGAAACTCGAGTTTCTTGTTCTCTTCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172475.2-2769s21c1
Sequence:CCGGAGCGTCAAAGCGCAGTTTAAGCTCGAGCTTAAACTGCGCTTTGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172475.2-939s21c1
Sequence:CCGGGTGAAGCCAAGGAAGATATTTCTCGAGAAATATCTTCCTTGGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172475.2-591s1c1
Sequence:CCGGGTTGACAGTGAAGTGGTATTTCTCGAGAAATACCACTTCACTGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172475.2-1111s21c1
Sequence:CCGGCCATTTGGGCGATGGCTATTACTCGAGTAATAGCCATCGCCCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172475.2-3755s21c1
Sequence:CCGGATATCAGTTTACACCTGAAATCTCGAGATTTCAGGTGTAAACTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172475
FRMD4A MISSION shRNA shRNA Plasmid DNA
FERM domain containing 4A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172475.2-1514s1c1
Sequence:CCGGGAGAATTGGAACAGCCTTCAACTCGAGTTGAAGGCTGTTCCAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172475.2-2239s1c1
Sequence:CCGGCCCACTATGTTCATTCCACAACTCGAGTTGTGGAATGAACATAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172475.2-846s1c1
Sequence:CCGGGTTCACTATTATGCAGTGAAACTCGAGTTTCACTGCATAATAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172475.2-482s1c1
Sequence:CCGGCTTCTGTGTCAGATTCTACATCTCGAGATGTAGAATCTGACACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172475.2-3645s1c1
Sequence:CCGGCCTGTAGAAGAGAACAAGAAACTCGAGTTTCTTGTTCTCTTCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172475.2-2769s21c1
Sequence:CCGGAGCGTCAAAGCGCAGTTTAAGCTCGAGCTTAAACTGCGCTTTGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172475.2-939s21c1
Sequence:CCGGGTGAAGCCAAGGAAGATATTTCTCGAGAAATATCTTCCTTGGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172475.2-591s1c1
Sequence:CCGGGTTGACAGTGAAGTGGTATTTCTCGAGAAATACCACTTCACTGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172475.2-1111s21c1
Sequence:CCGGCCATTTGGGCGATGGCTATTACTCGAGTAATAGCCATCGCCCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172475.2-3755s21c1
Sequence:CCGGATATCAGTTTACACCTGAAATCTCGAGATTTCAGGTGTAAACTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172475
FRMD4A MISSION shRNA Lentiviral Transduction Particles
FERM domain containing 4A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172475.2-1514s1c1
Sequence:CCGGGAGAATTGGAACAGCCTTCAACTCGAGTTGAAGGCTGTTCCAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172475.2-2239s1c1
Sequence:CCGGCCCACTATGTTCATTCCACAACTCGAGTTGTGGAATGAACATAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172475.2-846s1c1
Sequence:CCGGGTTCACTATTATGCAGTGAAACTCGAGTTTCACTGCATAATAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172475.2-482s1c1
Sequence:CCGGCTTCTGTGTCAGATTCTACATCTCGAGATGTAGAATCTGACACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172475.2-3645s1c1
Sequence:CCGGCCTGTAGAAGAGAACAAGAAACTCGAGTTTCTTGTTCTCTTCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172475.2-2769s21c1
Sequence:CCGGAGCGTCAAAGCGCAGTTTAAGCTCGAGCTTAAACTGCGCTTTGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172475.2-939s21c1
Sequence:CCGGGTGAAGCCAAGGAAGATATTTCTCGAGAAATATCTTCCTTGGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172475.2-591s1c1
Sequence:CCGGGTTGACAGTGAAGTGGTATTTCTCGAGAAATACCACTTCACTGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172475.2-1111s21c1
Sequence:CCGGCCATTTGGGCGATGGCTATTACTCGAGTAATAGCCATCGCCCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172475.2-3755s21c1
Sequence:CCGGATATCAGTTTACACCTGAAATCTCGAGATTTCAGGTGTAAACTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018027
VALIDATED
FRMD4A MISSION shRNA Bacterial Glycerol Stock
FERM domain containing 4A
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018027.2-5261s1c1
Sequence:CCGGGCAGAACTGAAGTTAGCTTAACTCGAGTTAAGCTAACTTCAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018027.2-1092s1c1
Sequence:CCGGCCAGTATGACTACCATGATAACTCGAGTTATCATGGTAGTCATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018027.2-1959s1c1
Sequence:CCGGGCTGATCATAGACGATGGAAACTCGAGTTTCCATCGTCTATGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018027.2-693s1c1
Sequence:CCGGCCTGAAGGATAATGCTACCATCTCGAGATGGTAGCATTATCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018027.2-4225s1c1
Sequence:CCGGGCCAAGAGGAAGACATTCTTTCTCGAGAAAGAATGTCTTCCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018027.2-1865s1c1
Sequence:CCGGCGTATCTGAATGCACTGAAGACTCGAGTCTTCAGTGCATTCAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018027.2-1762s1c1
Sequence:CCGGCTGGAACGAGAGTTTGCCATTCTCGAGAATGGCAAACTCTCGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018027.2-2166s1c1
Sequence:CCGGCGACTATGACAAGTCACCCATCTCGAGATGGGTGACTTGTCATAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142482    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018027.2-4916s1c1
Sequence:CCGGGCACCACATTTGTGTGCAGATCTCGAGATCTGCACACAAATGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018027.2-427s1c1
Sequence:CCGGCGCCGATGTCAAGTACATCTTCTCGAGAAGATGTACTTGACATCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018027.2-5779s1c1
Sequence:CCGGCCCAAAGAAGATTCATGGATACTCGAGTATCCATGAATCTTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018027.3-755s21c1
Sequence:CCGGAGCGAAGTGGTGTTTGAATTACTCGAGTAATTCAAACACCACTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018027.3-3451s21c1
Sequence:CCGGTCACCAAAGTACTGATGAATACTCGAGTATTCATCAGTACTTTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018027.3-577s21c1
Sequence:CCGGTCAGCTAGATCGAAGAGTATTCTCGAGAATACTCTTCGATCTAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018027
VALIDATED
FRMD4A MISSION shRNA shRNA Plasmid DNA
FERM domain containing 4A
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018027.2-5261s1c1
Sequence:CCGGGCAGAACTGAAGTTAGCTTAACTCGAGTTAAGCTAACTTCAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018027.2-1092s1c1
Sequence:CCGGCCAGTATGACTACCATGATAACTCGAGTTATCATGGTAGTCATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018027.2-1959s1c1
Sequence:CCGGGCTGATCATAGACGATGGAAACTCGAGTTTCCATCGTCTATGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018027.2-693s1c1
Sequence:CCGGCCTGAAGGATAATGCTACCATCTCGAGATGGTAGCATTATCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018027.2-4225s1c1
Sequence:CCGGGCCAAGAGGAAGACATTCTTTCTCGAGAAAGAATGTCTTCCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018027.2-1865s1c1
Sequence:CCGGCGTATCTGAATGCACTGAAGACTCGAGTCTTCAGTGCATTCAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018027.2-1762s1c1
Sequence:CCGGCTGGAACGAGAGTTTGCCATTCTCGAGAATGGCAAACTCTCGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018027.2-2166s1c1
Sequence:CCGGCGACTATGACAAGTCACCCATCTCGAGATGGGTGACTTGTCATAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142482    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018027.2-4916s1c1
Sequence:CCGGGCACCACATTTGTGTGCAGATCTCGAGATCTGCACACAAATGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018027.2-427s1c1
Sequence:CCGGCGCCGATGTCAAGTACATCTTCTCGAGAAGATGTACTTGACATCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018027.2-5779s1c1
Sequence:CCGGCCCAAAGAAGATTCATGGATACTCGAGTATCCATGAATCTTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018027.3-755s21c1
Sequence:CCGGAGCGAAGTGGTGTTTGAATTACTCGAGTAATTCAAACACCACTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018027.3-3451s21c1
Sequence:CCGGTCACCAAAGTACTGATGAATACTCGAGTATTCATCAGTACTTTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018027.3-577s21c1
Sequence:CCGGTCAGCTAGATCGAAGAGTATTCTCGAGAATACTCTTCGATCTAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018027
VALIDATED
FRMD4A MISSION shRNA Lentiviral Transduction Particles
FERM domain containing 4A
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018027.2-5261s1c1
Sequence:CCGGGCAGAACTGAAGTTAGCTTAACTCGAGTTAAGCTAACTTCAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018027.2-1092s1c1
Sequence:CCGGCCAGTATGACTACCATGATAACTCGAGTTATCATGGTAGTCATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018027.2-1959s1c1
Sequence:CCGGGCTGATCATAGACGATGGAAACTCGAGTTTCCATCGTCTATGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018027.2-693s1c1
Sequence:CCGGCCTGAAGGATAATGCTACCATCTCGAGATGGTAGCATTATCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018027.2-4225s1c1
Sequence:CCGGGCCAAGAGGAAGACATTCTTTCTCGAGAAAGAATGTCTTCCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018027.2-1865s1c1
Sequence:CCGGCGTATCTGAATGCACTGAAGACTCGAGTCTTCAGTGCATTCAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018027.2-1762s1c1
Sequence:CCGGCTGGAACGAGAGTTTGCCATTCTCGAGAATGGCAAACTCTCGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018027.2-2166s1c1
Sequence:CCGGCGACTATGACAAGTCACCCATCTCGAGATGGGTGACTTGTCATAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142482    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018027.2-4916s1c1
Sequence:CCGGGCACCACATTTGTGTGCAGATCTCGAGATCTGCACACAAATGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018027.2-427s1c1
Sequence:CCGGCGCCGATGTCAAGTACATCTTCTCGAGAAGATGTACTTGACATCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018027.2-5779s1c1
Sequence:CCGGCCCAAAGAAGATTCATGGATACTCGAGTATCCATGAATCTTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018027.3-755s21c1
Sequence:CCGGAGCGAAGTGGTGTTTGAATTACTCGAGTAATTCAAACACCACTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018027.3-3451s21c1
Sequence:CCGGTCACCAAAGTACTGATGAATACTCGAGTATTCATCAGTACTTTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018027.3-577s21c1
Sequence:CCGGTCAGCTAGATCGAAGAGTATTCTCGAGAATACTCTTCGATCTAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks