EMAIL THIS PAGE TO A FRIEND

FRMD4B

FERM domain containing 4B

163 Gene Product Result for
Synonyms: 6030440G05Rik GRSP1
UniProtKB ID: Q9Y2L6, Q8TAI3
Gene ID:
Mouse(232288) FERM domain containing 4B
Rat(252858) FERM domain containing 4B
domestic guinea pig(100721166) FERM domain containing 4B
naked mole-rat(101718023) FERM domain containing 4B
sheep(101105366) FERM domain containing 4B
Domestic Rabbit(100343973) FERM domain containing 4B
chicken(426071) FERM domain containing 4B
domestic cat(101090927) FERM domain containing 4B
cow(526127) FERM domain containing 4B
Horse(100063494) FERM domain containing 4B
dog(484693) FERM domain containing 4B
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145148 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145148 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145148 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015123 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015123 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015123 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015123 Rosetta Predictions human pricing
XM_114303 Rosetta Predictions human pricing
XM_931029 Rosetta Predictions human pricing
XM_931041 Rosetta Predictions human pricing
XM_001077268 Rosetta Predictions rat pricing
XM_232212 Rosetta Predictions rat pricing
NM_145148 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347025 predicted 1330
2 SASI_Hs02_00347026 predicted 816
3 SASI_Hs02_00347027 predicted 1159
4 SASI_Hs02_00347028 predicted 3425
5 SASI_Hs02_00347029 predicted 2046
6 SASI_Hs02_00347030 predicted 1281
7 SASI_Hs02_00347031 predicted 947
8 SASI_Hs02_00347032 predicted 3205
9 SASI_Hs02_00347033 predicted 2162
10 SASI_Hs02_00347034 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_114303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301474 predicted 941
2 SASI_Hs01_00301475 predicted 982
3 SASI_Hs01_00301476 predicted 469
4 SASI_Hs01_00301477 predicted 809
5 SASI_Hs01_00301478 predicted 3077
6 SASI_Hs01_00301479 predicted 1137
7 SASI_Hs01_00301480 predicted 1685
8 SASI_Hs01_00301481 predicted 934
9 SASI_Hs01_00301482 predicted 590
10 SASI_Hs01_00301483 predicted 1808
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248253 predicted 216
2 SASI_Hs01_00248254 predicted 426
3 SASI_Hs01_00248255 predicted 650
4 SASI_Hs01_00248256 predicted 412
5 SASI_Hs01_00248257 predicted 547
6 SASI_Hs01_00248258 predicted 563
7 SASI_Hs01_00248259 predicted 237
8 SASI_Hs01_00248260 predicted 420
9 SASI_Hs01_00248261 predicted 609
10 SASI_Hs01_00248262 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253107 predicted 1741
2 SASI_Hs01_00253108 predicted 354
3 SASI_Hs01_00253109 predicted 2452
4 SASI_Hs01_00253110 predicted 515
5 SASI_Hs01_00253111 predicted 499
6 SASI_Hs01_00253112 predicted 1068
7 SASI_Hs01_00253113 predicted 1667
8 SASI_Hs01_00253114 predicted 1184
9 SASI_Hs01_00253115 predicted 803
10 SASI_Hs01_00253116 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356480 predicted 1677
2 SASI_Rn02_00356481 predicted 837
3 SASI_Rn02_00356482 predicted 1653
4 SASI_Rn02_00356483 predicted 2952
5 SASI_Rn02_00356484 predicted 1218
6 SASI_Rn02_00356485 predicted 1533
7 SASI_Rn02_00356486 predicted 2221
8 SASI_Rn02_00356487 predicted 2765
9 SASI_Rn02_00356488 predicted 854
10 SASI_Rn02_00356489 predicted 3047
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232212 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387011 predicted 1677
2 SASI_Rn02_00387012 predicted 828
3 SASI_Rn02_00387013 predicted 1654
4 SASI_Rn02_00387014 predicted 2947
5 SASI_Rn02_00387015 predicted 1218
6 SASI_Rn02_00387016 predicted 1538
7 SASI_Rn02_00387017 predicted 2223
8 SASI_Rn02_00387018 predicted 2756
9 SASI_Rn02_00387019 predicted 849
10 SASI_Rn02_00387020 predicted 3042
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109863 predicted 713
2 SASI_Mm01_00109864 predicted 1264
3 SASI_Mm01_00109865 predicted 1222
4 SASI_Mm01_00109866 predicted 2638
5 SASI_Mm01_00109867 predicted 1095
6 SASI_Mm01_00109868 predicted 1555
7 SASI_Mm01_00109869 predicted 736
8 SASI_Mm01_00109870 predicted 1422
9 SASI_Mm01_00109871 predicted 3632
10 SASI_Mm02_00340553 predicted 1432
11 SASI_Mm01_00109862 predicted 2763
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145148
VALIDATED
FRMD4B MISSION shRNA Bacterial Glycerol Stock
FERM domain containing 4B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145148.2-693s21c1
Sequence:CCGGGCGTCGCATTTCAACCTGAAACTCGAGTTTCAGGTTGAAATGCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145148.2-2837s21c1
Sequence:CCGGCGGTTACTATATCGCTGGATACTCGAGTATCCAGCGATATAGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145148.2-1375s21c1
Sequence:CCGGCCCGAAGGATTTCAGTGTCTACTCGAGTAGACACTGAAATCCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145148.2-1268s21c1
Sequence:CCGGCCAGTATGACTTACAAGACAACTCGAGTTGTCTTGTAAGTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145148.1-616s1c1
Sequence:CCGGGCGTCGCATTTCAACCTGAAACTCGAGTTTCAGGTTGAAATGCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145148.1-2760s1c1
Sequence:CCGGCGGTTACTATATCGCTGGATACTCGAGTATCCAGCGATATAGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145148.1-2556s1c1
Sequence:CCGGCCAGTCAAGCTCCGAGTATTACTCGAGTAATACTCGGAGCTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145148.1-1191s1c1
Sequence:CCGGCCAGTATGACTTACAAGACAACTCGAGTTGTCTTGTAAGTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145148.1-1298s1c1
Sequence:CCGGCCCGAAGGATTTCAGTGTCTACTCGAGTAGACACTGAAATCCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145148
VALIDATED
FRMD4B MISSION shRNA shRNA Plasmid DNA
FERM domain containing 4B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145148.2-693s21c1
Sequence:CCGGGCGTCGCATTTCAACCTGAAACTCGAGTTTCAGGTTGAAATGCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145148.2-2837s21c1
Sequence:CCGGCGGTTACTATATCGCTGGATACTCGAGTATCCAGCGATATAGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145148.2-1375s21c1
Sequence:CCGGCCCGAAGGATTTCAGTGTCTACTCGAGTAGACACTGAAATCCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145148.2-1268s21c1
Sequence:CCGGCCAGTATGACTTACAAGACAACTCGAGTTGTCTTGTAAGTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145148.1-616s1c1
Sequence:CCGGGCGTCGCATTTCAACCTGAAACTCGAGTTTCAGGTTGAAATGCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145148.1-2760s1c1
Sequence:CCGGCGGTTACTATATCGCTGGATACTCGAGTATCCAGCGATATAGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145148.1-2556s1c1
Sequence:CCGGCCAGTCAAGCTCCGAGTATTACTCGAGTAATACTCGGAGCTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145148.1-1191s1c1
Sequence:CCGGCCAGTATGACTTACAAGACAACTCGAGTTGTCTTGTAAGTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145148.1-1298s1c1
Sequence:CCGGCCCGAAGGATTTCAGTGTCTACTCGAGTAGACACTGAAATCCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145148
VALIDATED
FRMD4B MISSION shRNA Lentiviral Transduction Particles
FERM domain containing 4B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145148.2-693s21c1
Sequence:CCGGGCGTCGCATTTCAACCTGAAACTCGAGTTTCAGGTTGAAATGCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145148.2-2837s21c1
Sequence:CCGGCGGTTACTATATCGCTGGATACTCGAGTATCCAGCGATATAGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145148.2-1375s21c1
Sequence:CCGGCCCGAAGGATTTCAGTGTCTACTCGAGTAGACACTGAAATCCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145148.2-1268s21c1
Sequence:CCGGCCAGTATGACTTACAAGACAACTCGAGTTGTCTTGTAAGTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145148.1-616s1c1
Sequence:CCGGGCGTCGCATTTCAACCTGAAACTCGAGTTTCAGGTTGAAATGCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145148.1-2760s1c1
Sequence:CCGGCGGTTACTATATCGCTGGATACTCGAGTATCCAGCGATATAGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145148.1-2556s1c1
Sequence:CCGGCCAGTCAAGCTCCGAGTATTACTCGAGTAATACTCGGAGCTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145148.1-1191s1c1
Sequence:CCGGCCAGTATGACTTACAAGACAACTCGAGTTGTCTTGTAAGTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145148.1-1298s1c1
Sequence:CCGGCCCGAAGGATTTCAGTGTCTACTCGAGTAGACACTGAAATCCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015123
FRMD4B MISSION shRNA Bacterial Glycerol Stock
FERM domain containing 4B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015123.1-1048s21c1
Sequence:CCGGCGACTTACGGTGTCCATTATTCTCGAGAATAATGGACACCGTAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015123.1-822s21c1
Sequence:CCGGTTCAAGTTAGCAGCGTTTATTCTCGAGAATAAACGCTGCTAACTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015123.1-4774s21c1
Sequence:CCGGTAAACTGGTCCTTAGTCATTTCTCGAGAAATGACTAAGGACCAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015123.1-644s21c1
Sequence:CCGGCCGAGTTCTTGACCACGATTTCTCGAGAAATCGTGGTCAAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015123.1-2397s21c1
Sequence:CCGGTCCGAGATGGACAGCGATAAGCTCGAGCTTATCGCTGTCCATCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015123
FRMD4B MISSION shRNA shRNA Plasmid DNA
FERM domain containing 4B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015123.1-1048s21c1
Sequence:CCGGCGACTTACGGTGTCCATTATTCTCGAGAATAATGGACACCGTAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015123.1-822s21c1
Sequence:CCGGTTCAAGTTAGCAGCGTTTATTCTCGAGAATAAACGCTGCTAACTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015123.1-4774s21c1
Sequence:CCGGTAAACTGGTCCTTAGTCATTTCTCGAGAAATGACTAAGGACCAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015123.1-644s21c1
Sequence:CCGGCCGAGTTCTTGACCACGATTTCTCGAGAAATCGTGGTCAAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015123.1-2397s21c1
Sequence:CCGGTCCGAGATGGACAGCGATAAGCTCGAGCTTATCGCTGTCCATCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015123
FRMD4B MISSION shRNA Lentiviral Transduction Particles
FERM domain containing 4B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015123.1-1048s21c1
Sequence:CCGGCGACTTACGGTGTCCATTATTCTCGAGAATAATGGACACCGTAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015123.1-822s21c1
Sequence:CCGGTTCAAGTTAGCAGCGTTTATTCTCGAGAATAAACGCTGCTAACTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015123.1-4774s21c1
Sequence:CCGGTAAACTGGTCCTTAGTCATTTCTCGAGAAATGACTAAGGACCAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015123.1-644s21c1
Sequence:CCGGCCGAGTTCTTGACCACGATTTCTCGAGAAATCGTGGTCAAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015123.1-2397s21c1
Sequence:CCGGTCCGAGATGGACAGCGATAAGCTCGAGCTTATCGCTGTCCATCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks