EMAIL THIS PAGE TO A FRIEND

FRMD5

FERM domain containing 5

UniProtKB ID: Q7Z6J6, Q8NBG4
Gene ID:
Mouse(228564) FERM domain containing 5
Rat(311362) FERM domain containing 5
Zebrafish(569968) FERM domain containing 5
cow(615161) FERM domain containing 5
Horse(100070709) FERM domain containing 5
domestic cat(101095585) FERM domain containing 5
dog(478282) FERM domain containing 5
chicken(415576) FERM domain containing 5
sheep(101111053) FERM domain containing 5
Domestic Rabbit(100328691) FERM domain containing 5
naked mole-rat(101699289) FERM domain containing 5
domestic guinea pig(100719254) FERM domain containing 5
Gene Class: Cytoskeleton
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032892 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032892 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032892 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032892 Rosetta Predictions human pricing
XM_001076895 Rosetta Predictions rat pricing
XM_230513 Rosetta Predictions rat pricing
NM_172673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065855 predicted 877
2 SASI_Hs02_00360515 predicted 929
3 SASI_Hs01_00065856 predicted 580
4 SASI_Hs01_00065857 predicted 1400
5 SASI_Hs01_00065858 predicted 489
6 SASI_Hs01_00065859 predicted 1227
7 SASI_Hs01_00065860 predicted 804
8 SASI_Hs01_00065861 predicted 700
9 SASI_Hs01_00065862 predicted 738
10 SASI_Hs01_00065863 predicted 1010
11 SASI_Hs01_00065864 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354959 predicted 1875
2 SASI_Rn02_00354960 predicted 664
3 SASI_Rn02_00354961 predicted 1484
4 SASI_Rn02_00354962 predicted 819
5 SASI_Rn02_00354963 predicted 462
6 SASI_Rn02_00354964 predicted 649
7 SASI_Rn02_00354965 predicted 1114
8 SASI_Rn02_00354966 predicted 1104
9 SASI_Rn02_00354967 predicted 892
10 SASI_Rn02_00354968 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386316 predicted 1867
2 SASI_Rn02_00386317 predicted 663
3 SASI_Rn02_00386318 predicted 1487
4 SASI_Rn02_00386319 predicted 819
5 SASI_Rn02_00386320 predicted 462
6 SASI_Rn02_00386321 predicted 650
7 SASI_Rn02_00386322 predicted 1109
8 SASI_Rn02_00386323 predicted 1105
9 SASI_Rn02_00386324 predicted 890
10 SASI_Rn02_00386325 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060320 predicted 1792
2 SASI_Mm01_00060321 predicted 631
3 SASI_Mm01_00060322 predicted 1195
4 SASI_Mm01_00060323 predicted 921
5 SASI_Mm01_00060324 predicted 384
6 SASI_Mm01_00060325 predicted 623
7 SASI_Mm01_00060326 predicted 1454
8 SASI_Mm01_00060327 predicted 751
9 SASI_Mm01_00060328 predicted 673
10 SASI_Mm01_00060329 predicted 539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032892
VALIDATED
FRMD5 MISSION shRNA Bacterial Glycerol Stock
FERM domain containing 5
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032892.2-1824s1c1
Sequence:CCGGGAGGAGGAGAAGGAATCTGAACTCGAGTTCAGATTCCTTCTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032892.2-2072s1c1
Sequence:CCGGCGAGTTCGAACAATTCCACTACTCGAGTAGTGGAATTGTTCGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032892.2-2347s1c1
Sequence:CCGGCCTGTCTAAACAAACTGGGAACTCGAGTTCCCAGTTTGTTTAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032892.2-2012s1c1
Sequence:CCGGGATCATCCTTACCGAGTCTGACTCGAGTCAGACTCGGTAAGGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032892.2-2420s1c1
Sequence:CCGGCATCTTTCCAATTTGCAGGATCTCGAGATCCTGCAAATTGGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032892.2-2073s1c1
Sequence:CCGGGAGTTCGAACAATTCCACTATCTCGAGATAGTGGAATTGTTCGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032892.2-1561s1c1
Sequence:CCGGGAAGAGCTGTTCACATCTCCACTCGAGTGGAGATGTGAACAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032892.2-2027s1c1
Sequence:CCGGGTCTGACCTTGACATTGCCTTCTCGAGAAGGCAATGTCAAGGTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032892.3-1968s21c1
Sequence:CCGGGCGGAACCATCGGCACATATACTCGAGTATATGTGCCGATGGTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-1669s21c1
Sequence:CCGGGTTCTAAGTGTCCTCCGTTTGCTCGAGCAAACGGAGGACACTTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-1088s21c1
Sequence:CCGGCAGTGTCCAGCAGCAATTTATCTCGAGATAAATTGCTGCTGGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-939s21c1
Sequence:CCGGGACTTTCTATTTATACGTAAGCTCGAGCTTACGTATAAATAGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-1800s21c1
Sequence:CCGGTGAACAATTCCACTATCAATACTCGAGTATTGATAGTGGAATTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-718s21c1
Sequence:CCGGACGGAACTGAGTGGTCAAACACTCGAGTGTTTGACCACTCAGTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-329s21c1
Sequence:CCGGACCTACTTGAGAAAGACTATTCTCGAGAATAGTCTTTCTCAAGTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032892
VALIDATED
FRMD5 MISSION shRNA shRNA Plasmid DNA
FERM domain containing 5
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032892.2-1824s1c1
Sequence:CCGGGAGGAGGAGAAGGAATCTGAACTCGAGTTCAGATTCCTTCTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032892.2-2072s1c1
Sequence:CCGGCGAGTTCGAACAATTCCACTACTCGAGTAGTGGAATTGTTCGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032892.2-2347s1c1
Sequence:CCGGCCTGTCTAAACAAACTGGGAACTCGAGTTCCCAGTTTGTTTAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032892.2-2012s1c1
Sequence:CCGGGATCATCCTTACCGAGTCTGACTCGAGTCAGACTCGGTAAGGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032892.2-2420s1c1
Sequence:CCGGCATCTTTCCAATTTGCAGGATCTCGAGATCCTGCAAATTGGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032892.2-2073s1c1
Sequence:CCGGGAGTTCGAACAATTCCACTATCTCGAGATAGTGGAATTGTTCGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032892.2-1561s1c1
Sequence:CCGGGAAGAGCTGTTCACATCTCCACTCGAGTGGAGATGTGAACAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032892.2-2027s1c1
Sequence:CCGGGTCTGACCTTGACATTGCCTTCTCGAGAAGGCAATGTCAAGGTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032892.3-1968s21c1
Sequence:CCGGGCGGAACCATCGGCACATATACTCGAGTATATGTGCCGATGGTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-1669s21c1
Sequence:CCGGGTTCTAAGTGTCCTCCGTTTGCTCGAGCAAACGGAGGACACTTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-1088s21c1
Sequence:CCGGCAGTGTCCAGCAGCAATTTATCTCGAGATAAATTGCTGCTGGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-939s21c1
Sequence:CCGGGACTTTCTATTTATACGTAAGCTCGAGCTTACGTATAAATAGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-1800s21c1
Sequence:CCGGTGAACAATTCCACTATCAATACTCGAGTATTGATAGTGGAATTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-718s21c1
Sequence:CCGGACGGAACTGAGTGGTCAAACACTCGAGTGTTTGACCACTCAGTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-329s21c1
Sequence:CCGGACCTACTTGAGAAAGACTATTCTCGAGAATAGTCTTTCTCAAGTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032892
VALIDATED
FRMD5 MISSION shRNA Lentiviral Transduction Particles
FERM domain containing 5
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032892.2-1824s1c1
Sequence:CCGGGAGGAGGAGAAGGAATCTGAACTCGAGTTCAGATTCCTTCTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032892.2-2072s1c1
Sequence:CCGGCGAGTTCGAACAATTCCACTACTCGAGTAGTGGAATTGTTCGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032892.2-2347s1c1
Sequence:CCGGCCTGTCTAAACAAACTGGGAACTCGAGTTCCCAGTTTGTTTAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032892.2-2012s1c1
Sequence:CCGGGATCATCCTTACCGAGTCTGACTCGAGTCAGACTCGGTAAGGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032892.2-2420s1c1
Sequence:CCGGCATCTTTCCAATTTGCAGGATCTCGAGATCCTGCAAATTGGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032892.2-2073s1c1
Sequence:CCGGGAGTTCGAACAATTCCACTATCTCGAGATAGTGGAATTGTTCGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032892.2-1561s1c1
Sequence:CCGGGAAGAGCTGTTCACATCTCCACTCGAGTGGAGATGTGAACAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032892.2-2027s1c1
Sequence:CCGGGTCTGACCTTGACATTGCCTTCTCGAGAAGGCAATGTCAAGGTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032892.3-1968s21c1
Sequence:CCGGGCGGAACCATCGGCACATATACTCGAGTATATGTGCCGATGGTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-1669s21c1
Sequence:CCGGGTTCTAAGTGTCCTCCGTTTGCTCGAGCAAACGGAGGACACTTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-1088s21c1
Sequence:CCGGCAGTGTCCAGCAGCAATTTATCTCGAGATAAATTGCTGCTGGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-939s21c1
Sequence:CCGGGACTTTCTATTTATACGTAAGCTCGAGCTTACGTATAAATAGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-1800s21c1
Sequence:CCGGTGAACAATTCCACTATCAATACTCGAGTATTGATAGTGGAATTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-718s21c1
Sequence:CCGGACGGAACTGAGTGGTCAAACACTCGAGTGTTTGACCACTCAGTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032892.3-329s21c1
Sequence:CCGGACCTACTTGAGAAAGACTATTCTCGAGAATAGTCTTTCTCAAGTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172673
FRMD5 MISSION shRNA Bacterial Glycerol Stock
FERM domain containing 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172673.2-895s1c1
Sequence:CCGGGTCCACTTCATTAAATGGAATCTCGAGATTCCATTTAATGAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172673.2-3650s1c1
Sequence:CCGGCCCAGAATCTTCAGGTCATTTCTCGAGAAATGACCTGAAGATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172673.2-1026s1c1
Sequence:CCGGGCACCTCTGGAAATGTGGAATCTCGAGATTCCACATTTCCAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172673.2-581s1c1
Sequence:CCGGCCGCCTTGTTAGCGGCCTATACTCGAGTATAGGCCGCTAACAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172673.2-709s1c1
Sequence:CCGGGCTGAGATTCACAAGACCGAACTCGAGTTCGGTCTTGTGAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172673
FRMD5 MISSION shRNA shRNA Plasmid DNA
FERM domain containing 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172673.2-895s1c1
Sequence:CCGGGTCCACTTCATTAAATGGAATCTCGAGATTCCATTTAATGAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172673.2-3650s1c1
Sequence:CCGGCCCAGAATCTTCAGGTCATTTCTCGAGAAATGACCTGAAGATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172673.2-1026s1c1
Sequence:CCGGGCACCTCTGGAAATGTGGAATCTCGAGATTCCACATTTCCAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172673.2-581s1c1
Sequence:CCGGCCGCCTTGTTAGCGGCCTATACTCGAGTATAGGCCGCTAACAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172673.2-709s1c1
Sequence:CCGGGCTGAGATTCACAAGACCGAACTCGAGTTCGGTCTTGTGAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172673
FRMD5 MISSION shRNA Lentiviral Transduction Particles
FERM domain containing 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172673.2-895s1c1
Sequence:CCGGGTCCACTTCATTAAATGGAATCTCGAGATTCCATTTAATGAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172673.2-3650s1c1
Sequence:CCGGCCCAGAATCTTCAGGTCATTTCTCGAGAAATGACCTGAAGATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172673.2-1026s1c1
Sequence:CCGGGCACCTCTGGAAATGTGGAATCTCGAGATTCCACATTTCCAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172673.2-581s1c1
Sequence:CCGGCCGCCTTGTTAGCGGCCTATACTCGAGTATAGGCCGCTAACAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172673.2-709s1c1
Sequence:CCGGGCTGAGATTCACAAGACCGAACTCGAGTTCGGTCTTGTGAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks