EMAIL THIS PAGE TO A FRIEND

FRMD6

FERM domain containing 6

Synonyms: C14orf31 EX1 Willin c14_5320
UniProtKB ID: Q96NE9, D3DSB9, Q5HYF2, Q8N2X1, Q8WUH7
Gene ID:
Mouse(319710) FERM domain containing 6
Rat(257646) FERM domain containing 6
domestic guinea pig(100730645) FERM domain containing 6
naked mole-rat(101719759) FERM domain containing 6
sheep(101106265) FERM domain containing 6
Zebrafish(321937) FERM domain containing 6
cow(530910) FERM domain containing 6
Horse(100051800) FERM domain containing 6
domestic cat(101097070) FERM domain containing 6
dog(490688) FERM domain containing 6
chicken(428930) FERM domain containing 6
243 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028127 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028127 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028127 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152330 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042481 Rosetta Predictions human pricing
NM_152330 Rosetta Predictions human pricing
XM_001064688 Rosetta Predictions rat pricing
XM_001080473 Rosetta Predictions rat pricing
NM_028127 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310078 predicted 782
2 SASI_Hs02_00310079 predicted 2364
3 SASI_Hs02_00310080 predicted 2405
4 SASI_Hs02_00310081 predicted 1809
5 SASI_Hs02_00310082 predicted 1261
6 SASI_Hs02_00310083 predicted 2160
7 SASI_Hs02_00310084 predicted 1515
8 SASI_Hs02_00310085 predicted 2106
9 SASI_Hs02_00310086 predicted 1996
10 SASI_Hs02_00310087 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365927 predicted 569
2 SASI_Hs01_00030872 predicted 2164
3 SASI_Hs01_00030873 predicted 2196
4 SASI_Hs01_00030874 predicted 1598
5 SASI_Hs01_00030875 predicted 1055
6 SASI_Hs01_00030876 predicted 1950
7 SASI_Hs01_00030878 predicted 1314
8 SASI_Hs01_00030879 predicted 1904
9 SASI_Hs02_00365928 predicted 1781
10 SASI_Hs01_00030880 predicted 851
11 SASI_Hs01_00030877 predicted 1250
12 SASI_Hs01_00030881 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311423 predicted 1825
2 SASI_Rn02_00311424 predicted 1154
3 SASI_Rn02_00311425 predicted 1614
4 SASI_Rn02_00311426 predicted 1815
5 SASI_Rn02_00311427 predicted 1806
6 SASI_Rn02_00311428 predicted 2322
7 SASI_Rn02_00311429 predicted 1508
8 SASI_Rn02_00311430 predicted 1209
9 SASI_Rn02_00311431 predicted 1224
10 SASI_Rn02_00311432 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080473 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368081 predicted 1819
2 SASI_Rn02_00368082 predicted 629
3 SASI_Rn02_00368083 predicted 1149
4 SASI_Rn02_00368084 predicted 1616
5 SASI_Rn02_00368085 predicted 1804
6 SASI_Rn02_00368086 predicted 606
7 SASI_Rn02_00368087 predicted 2326
8 SASI_Rn02_00368088 predicted 1506
9 SASI_Rn02_00368089 predicted 684
10 SASI_Rn02_00368090 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028127 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135723 predicted 484
2 SASI_Mm02_00333385 predicted 1647
3 SASI_Mm01_00135724 predicted 2164
4 SASI_Mm01_00135725 predicted 1661
5 SASI_Mm01_00135726 predicted 599
6 SASI_Mm01_00135727 predicted 446
7 SASI_Mm01_00135728 predicted 1646
8 SASI_Mm01_00135730 predicted 797
9 SASI_Mm01_00135731 predicted 865
10 SASI_Mm01_00135732 predicted 1048
11 SASI_Mm01_00135729 predicted 2082
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028127
VALIDATED
FRMD6 MISSION shRNA Bacterial Glycerol Stock
FERM domain containing 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028127.3-603s21c1
Sequence:CCGGCGAATTGCAAGATACTATTATCTCGAGATAATAGTATCTTGCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028127.3-305s21c1
Sequence:CCGGGTCCGTGAGCATCATCATAAACTCGAGTTTATGATGATGCTCACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028127.3-2144s21c1
Sequence:CCGGTGTGGAGTCTGAGGGTCTTTACTCGAGTAAAGACCCTCAGACTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028127.3-1708s21c1
Sequence:CCGGACGGACACTCAGGGTTAATTGCTCGAGCAATTAACCCTGAGTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028127.3-815s21c1
Sequence:CCGGCCTGAAACACATCCCAAACATCTCGAGATGTTTGGGATGTGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028127.3-1655s1c1
Sequence:CCGGCCCAGAGATGTGTATCTACATCTCGAGATGTAGATACACATCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028127.3-815s1c1
Sequence:CCGGCCTGAAACACATCCCAAACATCTCGAGATGTTTGGGATGTGTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028127.3-1717s1c1
Sequence:CCGGCAGGGTTAATTGTGAAAGAAACTCGAGTTTCTTTCACAATTAACCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028127.3-982s1c1
Sequence:CCGGCCATGCGAGGAATACAGATTTCTCGAGAAATCTGTATTCCTCGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028127.3-309s1c1
Sequence:CCGGGTGAGCATCATCATAAATGTTCTCGAGAACATTTATGATGATGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028127
VALIDATED
FRMD6 MISSION shRNA shRNA Plasmid DNA
FERM domain containing 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028127.3-603s21c1
Sequence:CCGGCGAATTGCAAGATACTATTATCTCGAGATAATAGTATCTTGCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028127.3-305s21c1
Sequence:CCGGGTCCGTGAGCATCATCATAAACTCGAGTTTATGATGATGCTCACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028127.3-2144s21c1
Sequence:CCGGTGTGGAGTCTGAGGGTCTTTACTCGAGTAAAGACCCTCAGACTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028127.3-1708s21c1
Sequence:CCGGACGGACACTCAGGGTTAATTGCTCGAGCAATTAACCCTGAGTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028127.3-815s21c1
Sequence:CCGGCCTGAAACACATCCCAAACATCTCGAGATGTTTGGGATGTGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028127.3-1655s1c1
Sequence:CCGGCCCAGAGATGTGTATCTACATCTCGAGATGTAGATACACATCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028127.3-815s1c1
Sequence:CCGGCCTGAAACACATCCCAAACATCTCGAGATGTTTGGGATGTGTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028127.3-1717s1c1
Sequence:CCGGCAGGGTTAATTGTGAAAGAAACTCGAGTTTCTTTCACAATTAACCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028127.3-982s1c1
Sequence:CCGGCCATGCGAGGAATACAGATTTCTCGAGAAATCTGTATTCCTCGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028127.3-309s1c1
Sequence:CCGGGTGAGCATCATCATAAATGTTCTCGAGAACATTTATGATGATGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028127
VALIDATED
FRMD6 MISSION shRNA Lentiviral Transduction Particles
FERM domain containing 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028127.3-603s21c1
Sequence:CCGGCGAATTGCAAGATACTATTATCTCGAGATAATAGTATCTTGCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028127.3-305s21c1
Sequence:CCGGGTCCGTGAGCATCATCATAAACTCGAGTTTATGATGATGCTCACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028127.3-2144s21c1
Sequence:CCGGTGTGGAGTCTGAGGGTCTTTACTCGAGTAAAGACCCTCAGACTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028127.3-1708s21c1
Sequence:CCGGACGGACACTCAGGGTTAATTGCTCGAGCAATTAACCCTGAGTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028127.3-815s21c1
Sequence:CCGGCCTGAAACACATCCCAAACATCTCGAGATGTTTGGGATGTGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028127.3-1655s1c1
Sequence:CCGGCCCAGAGATGTGTATCTACATCTCGAGATGTAGATACACATCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028127.3-815s1c1
Sequence:CCGGCCTGAAACACATCCCAAACATCTCGAGATGTTTGGGATGTGTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028127.3-1717s1c1
Sequence:CCGGCAGGGTTAATTGTGAAAGAAACTCGAGTTTCTTTCACAATTAACCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028127.3-982s1c1
Sequence:CCGGCCATGCGAGGAATACAGATTTCTCGAGAAATCTGTATTCCTCGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028127.3-309s1c1
Sequence:CCGGGTGAGCATCATCATAAATGTTCTCGAGAACATTTATGATGATGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152330
VALIDATED
FRMD6 MISSION shRNA Bacterial Glycerol Stock
FERM domain containing 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152330.2-803s1c1
Sequence:CCGGGCACATTCCAAACATGCACAACTCGAGTTGTGCATGTTTGGAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152330.2-4062s1c1
Sequence:CCGGCCACCATTTCTTATGGATGATCTCGAGATCATCCATAAGAAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152330.2-2176s1c1
Sequence:CCGGCCCTAAACATAGCTCTTTCTTCTCGAGAAGAAAGAGCTATGTTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152330.2-3166s1c1
Sequence:CCGGGCCATGATTCTCAACACTGATCTCGAGATCAGTGTTGAGAATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152330.2-1788s1c1
Sequence:CCGGCCACAGACTATATGTCGGAAACTCGAGTTTCCGACATATAGTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152330.2-947s1c1
Sequence:CCGGGCTGACTCTTGGATTGACCATCTCGAGATGGTCAATCCAAGAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152330.2-1841s1c1
Sequence:CCGGCCTCGATGACATCAGACTTTACTCGAGTAAAGTCTGATGTCATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152330.2-2052s1c1
Sequence:CCGGGATGAAGTTCCAGAGTTTGTTCTCGAGAACAAACTCTGGAACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152330
VALIDATED
FRMD6 MISSION shRNA shRNA Plasmid DNA
FERM domain containing 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152330.2-803s1c1
Sequence:CCGGGCACATTCCAAACATGCACAACTCGAGTTGTGCATGTTTGGAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152330.2-4062s1c1
Sequence:CCGGCCACCATTTCTTATGGATGATCTCGAGATCATCCATAAGAAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152330.2-2176s1c1
Sequence:CCGGCCCTAAACATAGCTCTTTCTTCTCGAGAAGAAAGAGCTATGTTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152330.2-3166s1c1
Sequence:CCGGGCCATGATTCTCAACACTGATCTCGAGATCAGTGTTGAGAATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152330.2-1788s1c1
Sequence:CCGGCCACAGACTATATGTCGGAAACTCGAGTTTCCGACATATAGTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152330.2-947s1c1
Sequence:CCGGGCTGACTCTTGGATTGACCATCTCGAGATGGTCAATCCAAGAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152330.2-1841s1c1
Sequence:CCGGCCTCGATGACATCAGACTTTACTCGAGTAAAGTCTGATGTCATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152330.2-2052s1c1
Sequence:CCGGGATGAAGTTCCAGAGTTTGTTCTCGAGAACAAACTCTGGAACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152330
VALIDATED
FRMD6 MISSION shRNA Lentiviral Transduction Particles
FERM domain containing 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152330.2-803s1c1
Sequence:CCGGGCACATTCCAAACATGCACAACTCGAGTTGTGCATGTTTGGAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152330.2-4062s1c1
Sequence:CCGGCCACCATTTCTTATGGATGATCTCGAGATCATCCATAAGAAATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152330.2-2176s1c1
Sequence:CCGGCCCTAAACATAGCTCTTTCTTCTCGAGAAGAAAGAGCTATGTTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152330.2-3166s1c1
Sequence:CCGGGCCATGATTCTCAACACTGATCTCGAGATCAGTGTTGAGAATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152330.2-1788s1c1
Sequence:CCGGCCACAGACTATATGTCGGAAACTCGAGTTTCCGACATATAGTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152330.2-947s1c1
Sequence:CCGGGCTGACTCTTGGATTGACCATCTCGAGATGGTCAATCCAAGAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152330.2-1841s1c1
Sequence:CCGGCCTCGATGACATCAGACTTTACTCGAGTAAAGTCTGATGTCATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152330.2-2052s1c1
Sequence:CCGGGATGAAGTTCCAGAGTTTGTTCTCGAGAACAAACTCTGGAACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks