EMAIL THIS PAGE TO A FRIEND

FRMD7

FERM domain containing 7

Synonyms: NYS NYS1 XIPAN
UniProtKB ID: Q6ZUT3, C0LLJ3, Q5JX99
Gene ID:
Human(90167) Summary: Mutations in this gene are associated with X-linked congenital nystagmus. [provided by RefSeq, Dec 2008]
Mouse(385354) FERM domain containing 7
Rat(302826) FERM domain containing 7
Zebrafish(751637) FERM domain containing 7
chicken(428710) FERM domain containing 7
dog(492141) FERM domain containing 7
cow(539933) FERM domain containing 7
Horse(100054408) FERM domain containing 7
domestic cat(101093505) FERM domain containing 7
sheep(101111523) FERM domain containing 7
naked mole-rat(101702823) FERM domain containing 7
domestic guinea pig(100723782) FERM domain containing 7
Gene Class: Cytoskeleton
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194277 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194277 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194277 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010581 MISSION® esiRNA esiRNA targeting human FRMD7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194277 Rosetta Predictions human pricing
XM_001070241 Rosetta Predictions rat pricing
XM_229144 Rosetta Predictions rat pricing
NM_001037750 Rosetta Predictions mouse pricing
XM_001477880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014944 predicted 886
2 SASI_Hs02_00371386 predicted 2157
3 SASI_Hs01_00014946 predicted 1076
4 SASI_Hs01_00014947 predicted 448
5 SASI_Hs01_00014948 predicted 2071
6 SASI_Hs01_00014949 predicted 1592
7 SASI_Hs02_00371387 predicted 525
8 SASI_Hs01_00014950 predicted 1857
9 SASI_Hs01_00014951 predicted 903
10 SASI_Hs01_00014953 predicted 486
11 SASI_Hs01_00014945 predicted 1535
12 SASI_Hs01_00014952 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330971 predicted 475
2 SASI_Rn02_00330972 predicted 508
3 SASI_Rn02_00330973 predicted 974
4 SASI_Rn02_00330974 predicted 1301
5 SASI_Rn02_00330975 predicted 1250
6 SASI_Rn02_00330976 predicted 1681
7 SASI_Rn02_00330977 predicted 314
8 SASI_Rn02_00330978 predicted 844
9 SASI_Rn02_00330979 predicted 434
10 SASI_Rn02_00330980 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_229144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385846 predicted 473
2 SASI_Rn02_00385847 predicted 506
3 SASI_Rn02_00385848 predicted 980
4 SASI_Rn02_00385849 predicted 1308
5 SASI_Rn02_00385850 predicted 1251
6 SASI_Rn02_00385851 predicted 1686
7 SASI_Rn02_00385852 predicted 320
8 SASI_Rn02_00385853 predicted 846
9 SASI_Rn02_00385854 predicted 431
10 SASI_Rn02_00385855 predicted 1479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127639 predicted 550
2 SASI_Mm01_00127640 predicted 476
3 SASI_Mm01_00127641 predicted 348
4 SASI_Mm01_00127642 predicted 482
5 SASI_Mm01_00127643 predicted 206
6 SASI_Mm01_00127644 predicted 267
7 SASI_Mm01_00127645 predicted 672
8 SASI_Mm01_00127646 predicted 428
9 SASI_Mm01_00127647 predicted 414
10 SASI_Mm01_00127648 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00398709 predicted 407
2 SASI_Mm02_00398710 predicted 1726
3 SASI_Mm02_00398711 predicted 492
4 SASI_Mm02_00398712 predicted 1202
5 SASI_Mm02_00398713 predicted 1907
6 SASI_Mm02_00398714 predicted 904
7 SASI_Mm02_00398715 predicted 1912
8 SASI_Mm02_00398716 predicted 851
9 SASI_Mm02_00398717 predicted 895
10 SASI_Mm02_00398718 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194277
FRMD7 MISSION shRNA Bacterial Glycerol Stock
FERM domain containing 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194277.1-641s1c1
Sequence:CCGGGAGGGCAAGATCATGCACTTTCTCGAGAAAGTGCATGATCTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194277.1-2781s1c1
Sequence:CCGGCCAGTAGAAATGGTCTTGTAACTCGAGTTACAAGACCATTTCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194277.1-1780s1c1
Sequence:CCGGCCCAAGGAATATCAGAATGAACTCGAGTTCATTCTGATATTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135031    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194277.1-2975s1c1
Sequence:CCGGCCAGACATAAACCAGATGAAACTCGAGTTTCATCTGGTTTATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136077    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194277.1-2974s1c1
Sequence:CCGGGCCAGACATAAACCAGATGAACTCGAGTTCATCTGGTTTATGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194277.1-2637s1c1
Sequence:CCGGGCTGAAGAATGGTGACAGTATCTCGAGATACTGTCACCATTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194277.2-2557s21c1
Sequence:CCGGGCAAGGCAAGGTGGGTATTTGCTCGAGCAAATACCCACCTTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194277.2-1062s21c1
Sequence:CCGGAGGGTTCCAGTTTCCGCTATACTCGAGTATAGCGGAAACTGGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194277
FRMD7 MISSION shRNA shRNA Plasmid DNA
FERM domain containing 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194277.1-641s1c1
Sequence:CCGGGAGGGCAAGATCATGCACTTTCTCGAGAAAGTGCATGATCTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194277.1-2781s1c1
Sequence:CCGGCCAGTAGAAATGGTCTTGTAACTCGAGTTACAAGACCATTTCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194277.1-1780s1c1
Sequence:CCGGCCCAAGGAATATCAGAATGAACTCGAGTTCATTCTGATATTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135031    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194277.1-2975s1c1
Sequence:CCGGCCAGACATAAACCAGATGAAACTCGAGTTTCATCTGGTTTATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136077    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194277.1-2974s1c1
Sequence:CCGGGCCAGACATAAACCAGATGAACTCGAGTTCATCTGGTTTATGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194277.1-2637s1c1
Sequence:CCGGGCTGAAGAATGGTGACAGTATCTCGAGATACTGTCACCATTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194277.2-2557s21c1
Sequence:CCGGGCAAGGCAAGGTGGGTATTTGCTCGAGCAAATACCCACCTTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194277.2-1062s21c1
Sequence:CCGGAGGGTTCCAGTTTCCGCTATACTCGAGTATAGCGGAAACTGGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194277
FRMD7 MISSION shRNA Lentiviral Transduction Particles
FERM domain containing 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194277.1-641s1c1
Sequence:CCGGGAGGGCAAGATCATGCACTTTCTCGAGAAAGTGCATGATCTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194277.1-2781s1c1
Sequence:CCGGCCAGTAGAAATGGTCTTGTAACTCGAGTTACAAGACCATTTCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194277.1-1780s1c1
Sequence:CCGGCCCAAGGAATATCAGAATGAACTCGAGTTCATTCTGATATTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135031    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194277.1-2975s1c1
Sequence:CCGGCCAGACATAAACCAGATGAAACTCGAGTTTCATCTGGTTTATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136077    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194277.1-2974s1c1
Sequence:CCGGGCCAGACATAAACCAGATGAACTCGAGTTCATCTGGTTTATGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194277.1-2637s1c1
Sequence:CCGGGCTGAAGAATGGTGACAGTATCTCGAGATACTGTCACCATTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194277.2-2557s21c1
Sequence:CCGGGCAAGGCAAGGTGGGTATTTGCTCGAGCAAATACCCACCTTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194277.2-1062s21c1
Sequence:CCGGAGGGTTCCAGTTTCCGCTATACTCGAGTATAGCGGAAACTGGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks