EMAIL THIS PAGE TO A FRIEND

FRMD8

FERM domain containing 8

UniProtKB ID: Q9BZ67, Q86V56, Q8NCB5
Gene ID:
Mouse(67457) FERM domain containing 8
Rat(309172) FERM domain containing 8
domestic guinea pig(100728699) FERM domain containing 8
naked mole-rat(101722795) FERM domain containing 8
Goat(100861121) FERM domain containing 8
sheep(101122481) FERM domain containing 8
Zebrafish(559410) FERM domain containing 8
dog(483739) FERM domain containing 8
cow(515469) FERM domain containing 8
domestic cat(101085574) FERM domain containing 8
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031904 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026169 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026169 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026169 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031904 Rosetta Predictions human pricing
NM_001008348 Rosetta Predictions rat pricing
NM_026169 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359030 predicted 524
2 SASI_Hs01_00247205 predicted 1965
3 SASI_Hs01_00247207 predicted 2065
4 SASI_Hs01_00247209 predicted 1989
5 SASI_Hs01_00247210 predicted 1366
6 SASI_Hs02_00359031 predicted 1079
7 SASI_Hs02_00359032 predicted 1094
8 SASI_Hs01_00247204 predicted 1988
9 SASI_Hs01_00247201 predicted 1152
10 SASI_Hs01_00247202 predicted 387
11 SASI_Hs01_00247203 predicted 448
12 SASI_Hs01_00247206 predicted 472
13 SASI_Hs01_00247208 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008348 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059609 predicted 940
2 SASI_Rn01_00059610 predicted 428
3 SASI_Rn01_00059611 predicted 519
4 SASI_Rn01_00059612 predicted 1519
5 SASI_Rn01_00059613 predicted 1834
6 SASI_Rn01_00059614 predicted 2011
7 SASI_Rn01_00059615 predicted 1631
8 SASI_Rn01_00059616 predicted 2038
9 SASI_Rn02_00199100 predicted 1041
10 SASI_Rn01_00059617 predicted 293
11 SASI_Rn01_00059608 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026169 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177092 predicted 1541
2 SASI_Mm01_00177093 predicted 213
3 SASI_Mm01_00177094 predicted 377
4 SASI_Mm01_00177095 predicted 393
5 SASI_Mm01_00177096 predicted 252
6 SASI_Mm01_00177097 predicted 1200
7 SASI_Mm01_00177098 predicted 512
8 SASI_Mm01_00177099 predicted 450
9 SASI_Mm01_00177100 predicted 203
10 SASI_Mm02_00329806 predicted 1908
11 SASI_Mm01_00177091 predicted 912
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031904
FRMD8 MISSION shRNA Bacterial Glycerol Stock
FERM domain containing 8
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031904.3-2286s21c1
Sequence:CCGGTCCTTTGCAGGCACGAGATACCTCGAGGTATCTCGTGCCTGCAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031904.3-1235s21c1
Sequence:CCGGACAAGCTCCTCAAGATCTACTCTCGAGAGTAGATCTTGAGGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031904.3-281s21c1
Sequence:CCGGCTGACGTGCTGGTATACCTAGCTCGAGCTAGGTATACCAGCACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031904.3-1284s21c1
Sequence:CCGGCATTGAGTACTGCATCGAACTCTCGAGAGTTCGATGCAGTACTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031904.2-487s1c1
Sequence:CCGGGAAGGAACGTGTTCTTCCCAACTCGAGTTGGGAAGAACACGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031904.2-1016s1c1
Sequence:CCGGCGTCATCGATAGCAGAGAGAACTCGAGTTCTCTCTGCTATCGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031904
FRMD8 MISSION shRNA shRNA Plasmid DNA
FERM domain containing 8
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031904.3-2286s21c1
Sequence:CCGGTCCTTTGCAGGCACGAGATACCTCGAGGTATCTCGTGCCTGCAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031904.3-1235s21c1
Sequence:CCGGACAAGCTCCTCAAGATCTACTCTCGAGAGTAGATCTTGAGGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031904.3-281s21c1
Sequence:CCGGCTGACGTGCTGGTATACCTAGCTCGAGCTAGGTATACCAGCACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031904.3-1284s21c1
Sequence:CCGGCATTGAGTACTGCATCGAACTCTCGAGAGTTCGATGCAGTACTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031904.2-487s1c1
Sequence:CCGGGAAGGAACGTGTTCTTCCCAACTCGAGTTGGGAAGAACACGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031904.2-1016s1c1
Sequence:CCGGCGTCATCGATAGCAGAGAGAACTCGAGTTCTCTCTGCTATCGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031904
FRMD8 MISSION shRNA Lentiviral Transduction Particles
FERM domain containing 8
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031904.3-2286s21c1
Sequence:CCGGTCCTTTGCAGGCACGAGATACCTCGAGGTATCTCGTGCCTGCAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031904.3-1235s21c1
Sequence:CCGGACAAGCTCCTCAAGATCTACTCTCGAGAGTAGATCTTGAGGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031904.3-281s21c1
Sequence:CCGGCTGACGTGCTGGTATACCTAGCTCGAGCTAGGTATACCAGCACGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031904.3-1284s21c1
Sequence:CCGGCATTGAGTACTGCATCGAACTCTCGAGAGTTCGATGCAGTACTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031904.2-487s1c1
Sequence:CCGGGAAGGAACGTGTTCTTCCCAACTCGAGTTGGGAAGAACACGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031904.2-1016s1c1
Sequence:CCGGCGTCATCGATAGCAGAGAGAACTCGAGTTCTCTCTGCTATCGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026169
VALIDATED
FRMD8 MISSION shRNA Bacterial Glycerol Stock
FERM domain containing 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026169.3-2442s1c1
Sequence:CCGGCCAGAGACATAGCTTAGCTTTCTCGAGAAAGCTAAGCTATGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026169.3-1170s1c1
Sequence:CCGGGCTGCTAAGGATCTACTCCAACTCGAGTTGGAGTAGATCCTTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026169.3-1358s1c1
Sequence:CCGGGCCGGATTCAGCATCTCTCTACTCGAGTAGAGAGATGCTGAATCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026169.3-170s1c1
Sequence:CCGGCCCACCGAAGTAGCGTCTCTTCTCGAGAAGAGACGCTACTTCGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026169.3-254s1c1
Sequence:CCGGCCGTGGAGAATTTGTCCTCAACTCGAGTTGAGGACAAATTCTCCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026169
VALIDATED
FRMD8 MISSION shRNA shRNA Plasmid DNA
FERM domain containing 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026169.3-2442s1c1
Sequence:CCGGCCAGAGACATAGCTTAGCTTTCTCGAGAAAGCTAAGCTATGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026169.3-1170s1c1
Sequence:CCGGGCTGCTAAGGATCTACTCCAACTCGAGTTGGAGTAGATCCTTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026169.3-1358s1c1
Sequence:CCGGGCCGGATTCAGCATCTCTCTACTCGAGTAGAGAGATGCTGAATCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026169.3-170s1c1
Sequence:CCGGCCCACCGAAGTAGCGTCTCTTCTCGAGAAGAGACGCTACTTCGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026169.3-254s1c1
Sequence:CCGGCCGTGGAGAATTTGTCCTCAACTCGAGTTGAGGACAAATTCTCCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026169
VALIDATED
FRMD8 MISSION shRNA Lentiviral Transduction Particles
FERM domain containing 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026169.3-2442s1c1
Sequence:CCGGCCAGAGACATAGCTTAGCTTTCTCGAGAAAGCTAAGCTATGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026169.3-1170s1c1
Sequence:CCGGGCTGCTAAGGATCTACTCCAACTCGAGTTGGAGTAGATCCTTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026169.3-1358s1c1
Sequence:CCGGGCCGGATTCAGCATCTCTCTACTCGAGTAGAGAGATGCTGAATCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026169.3-170s1c1
Sequence:CCGGCCCACCGAAGTAGCGTCTCTTCTCGAGAAGAGACGCTACTTCGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026169.3-254s1c1
Sequence:CCGGCCGTGGAGAATTTGTCCTCAACTCGAGTTGAGGACAAATTCTCCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks