EMAIL THIS PAGE TO A FRIEND

FRMPD1

FERM and PDZ domain containing 1

78 Gene Product Result for
Synonyms: FRMD2
UniProtKB ID: Q5SYB0, D3DRQ3, Q14C73, Q5HY96, Q9Y2H3
Gene ID:
Mouse(666060) FERM and PDZ domain containing 1
Rat(313244) FERM and PDZ domain containing 1
chicken(100859250) FERM and PDZ domain containing 1
domestic cat(101080582) FERM and PDZ domain containing 1
cow(616412) FERM and PDZ domain containing 1
Horse(100066353) FERM and PDZ domain containing 1
dog(481614) FERM and PDZ domain containing 1
sheep(101106908) FERM and PDZ domain containing 1
Domestic Rabbit(100343692) FERM and PDZ domain containing 1
naked mole-rat(101705567) FERM and PDZ domain containing 1
domestic guinea pig(100714210) FERM and PDZ domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014907 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081172 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081172 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081172 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014907 Rosetta Predictions human pricing
NM_001107937 Rosetta Predictions rat pricing
NM_001081172 Rosetta Predictions mouse pricing
XM_204152 Rosetta Predictions mouse pricing
XM_898920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241036 predicted 1399
2 SASI_Hs01_00241037 predicted 2569
3 SASI_Hs01_00241038 predicted 245
4 SASI_Hs01_00241039 predicted 1098
5 SASI_Hs01_00241040 predicted 2896
6 SASI_Hs02_00346545 predicted 4618
7 SASI_Hs01_00241041 predicted 2860
8 SASI_Hs01_00241043 predicted 1244
9 SASI_Hs02_00346546 predicted 3639
10 SASI_Hs01_00241044 predicted 1276
11 SASI_Hs01_00241042 predicted 1123
12 SASI_Hs01_00241045 predicted 3862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233755 predicted 2381
2 SASI_Rn02_00233756 predicted 1433
3 SASI_Rn02_00233757 predicted 372
4 SASI_Rn02_00233758 predicted 427
5 SASI_Rn02_00233759 predicted 453
6 SASI_Rn02_00233760 predicted 670
7 SASI_Rn02_00233761 predicted 1108
8 SASI_Rn02_00233762 predicted 1292
9 SASI_Rn02_00233763 predicted 1121
10 SASI_Rn02_00233764 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295891 predicted 4307
2 SASI_Mm02_00295892 predicted 4349
3 SASI_Mm02_00295893 predicted 1261
4 SASI_Mm02_00295894 predicted 3183
5 SASI_Mm02_00295895 predicted 2353
6 SASI_Mm02_00295896 predicted 1439
7 SASI_Mm02_00295897 predicted 1083
8 SASI_Mm02_00295898 predicted 1523
9 SASI_Mm02_00295899 predicted 3109
10 SASI_Mm02_00295900 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_204152 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206878 predicted 4314
2 SASI_Mm01_00206879 predicted 4349
3 SASI_Mm01_00206880 predicted 422
4 SASI_Mm01_00206881 predicted 1263
5 SASI_Mm01_00206882 predicted 3187
6 SASI_Mm01_00206883 predicted 2368
7 SASI_Mm01_00206884 predicted 1124
8 SASI_Mm01_00206885 predicted 1451
9 SASI_Mm01_00206886 predicted 1083
10 SASI_Mm01_00206887 predicted 1525
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224861 predicted 3595
2 SASI_Mm01_00224862 predicted 3632
3 SASI_Mm01_00224863 predicted 543
4 SASI_Mm01_00224864 predicted 2470
5 SASI_Mm01_00224865 predicted 1644
6 SASI_Mm01_00224866 predicted 416
7 SASI_Mm01_00224867 predicted 738
8 SASI_Mm01_00224868 predicted 365
9 SASI_Mm01_00224869 predicted 806
10 SASI_Mm01_00224870 predicted 383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014907
FRMPD1 MISSION shRNA Bacterial Glycerol Stock
FERM and PDZ domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014907.1-590s1c1
Sequence:CCGGGCTCAAGCTATACTTGGAGAACTCGAGTTCTCCAAGTATAGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014907.1-3665s1c1
Sequence:CCGGCCCTGATTTCTTTCTTGGGAACTCGAGTTCCCAAGAAAGAAATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014907.1-243s1c1
Sequence:CCGGCAGGACTATGGATTTCACATTCTCGAGAATGTGAAATCCATAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014907.1-3326s1c1
Sequence:CCGGGATAGCTTCTATCCCTACAAACTCGAGTTTGTAGGGATAGAAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014907.1-591s1c1
Sequence:CCGGCTCAAGCTATACTTGGAGAATCTCGAGATTCTCCAAGTATAGCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014907.1-1109s1c1
Sequence:CCGGGAAAGCCATTAGCTTCCACATCTCGAGATGTGGAAGCTAATGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014907.2-1312s21c1
Sequence:CCGGGGATTAGCCAGGTTATCAATACTCGAGTATTGATAACCTGGCTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014907.2-2632s21c1
Sequence:CCGGTAGACGACGTGTGCTACTATGCTCGAGCATAGTAGCACACGTCGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014907.2-75s21c1
Sequence:CCGGACACGGAAAGCACATAGAATACTCGAGTATTCTATGTGCTTTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014907.2-1178s21c1
Sequence:CCGGTGCTGCCCAGCTACGTTTAAACTCGAGTTTAAACGTAGCTGGGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014907
FRMPD1 MISSION shRNA shRNA Plasmid DNA
FERM and PDZ domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014907.1-590s1c1
Sequence:CCGGGCTCAAGCTATACTTGGAGAACTCGAGTTCTCCAAGTATAGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014907.1-3665s1c1
Sequence:CCGGCCCTGATTTCTTTCTTGGGAACTCGAGTTCCCAAGAAAGAAATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014907.1-243s1c1
Sequence:CCGGCAGGACTATGGATTTCACATTCTCGAGAATGTGAAATCCATAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014907.1-3326s1c1
Sequence:CCGGGATAGCTTCTATCCCTACAAACTCGAGTTTGTAGGGATAGAAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014907.1-591s1c1
Sequence:CCGGCTCAAGCTATACTTGGAGAATCTCGAGATTCTCCAAGTATAGCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014907.1-1109s1c1
Sequence:CCGGGAAAGCCATTAGCTTCCACATCTCGAGATGTGGAAGCTAATGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014907.2-1312s21c1
Sequence:CCGGGGATTAGCCAGGTTATCAATACTCGAGTATTGATAACCTGGCTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014907.2-2632s21c1
Sequence:CCGGTAGACGACGTGTGCTACTATGCTCGAGCATAGTAGCACACGTCGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014907.2-75s21c1
Sequence:CCGGACACGGAAAGCACATAGAATACTCGAGTATTCTATGTGCTTTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014907.2-1178s21c1
Sequence:CCGGTGCTGCCCAGCTACGTTTAAACTCGAGTTTAAACGTAGCTGGGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014907
FRMPD1 MISSION shRNA Lentiviral Transduction Particles
FERM and PDZ domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014907.1-590s1c1
Sequence:CCGGGCTCAAGCTATACTTGGAGAACTCGAGTTCTCCAAGTATAGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014907.1-3665s1c1
Sequence:CCGGCCCTGATTTCTTTCTTGGGAACTCGAGTTCCCAAGAAAGAAATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014907.1-243s1c1
Sequence:CCGGCAGGACTATGGATTTCACATTCTCGAGAATGTGAAATCCATAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014907.1-3326s1c1
Sequence:CCGGGATAGCTTCTATCCCTACAAACTCGAGTTTGTAGGGATAGAAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014907.1-591s1c1
Sequence:CCGGCTCAAGCTATACTTGGAGAATCTCGAGATTCTCCAAGTATAGCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014907.1-1109s1c1
Sequence:CCGGGAAAGCCATTAGCTTCCACATCTCGAGATGTGGAAGCTAATGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014907.2-1312s21c1
Sequence:CCGGGGATTAGCCAGGTTATCAATACTCGAGTATTGATAACCTGGCTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014907.2-2632s21c1
Sequence:CCGGTAGACGACGTGTGCTACTATGCTCGAGCATAGTAGCACACGTCGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014907.2-75s21c1
Sequence:CCGGACACGGAAAGCACATAGAATACTCGAGTATTCTATGTGCTTTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014907.2-1178s21c1
Sequence:CCGGTGCTGCCCAGCTACGTTTAAACTCGAGTTTAAACGTAGCTGGGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081172
FRMPD1 MISSION shRNA Bacterial Glycerol Stock
FERM and PDZ domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081172.2-1082s21c1
Sequence:CCGGTCCAACTTTACTCCGAAATATCTCGAGATATTTCGGAGTAAAGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081172.2-3814s21c1
Sequence:CCGGGTGACGACAGTCCTATCATTTCTCGAGAAATGATAGGACTGTCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081172.2-2160s21c1
Sequence:CCGGAGCCGGACTGACTACTATAACCTCGAGGTTATAGTAGTCAGTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081172.2-1191s21c1
Sequence:CCGGGCTGCTCAGCTACGCTTAAATCTCGAGATTTAAGCGTAGCTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081172.2-394s21c1
Sequence:CCGGGTGAACGAGCGGCTGATATTCCTCGAGGAATATCAGCCGCTCGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081172
FRMPD1 MISSION shRNA shRNA Plasmid DNA
FERM and PDZ domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081172.2-1082s21c1
Sequence:CCGGTCCAACTTTACTCCGAAATATCTCGAGATATTTCGGAGTAAAGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081172.2-3814s21c1
Sequence:CCGGGTGACGACAGTCCTATCATTTCTCGAGAAATGATAGGACTGTCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081172.2-2160s21c1
Sequence:CCGGAGCCGGACTGACTACTATAACCTCGAGGTTATAGTAGTCAGTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081172.2-1191s21c1
Sequence:CCGGGCTGCTCAGCTACGCTTAAATCTCGAGATTTAAGCGTAGCTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081172.2-394s21c1
Sequence:CCGGGTGAACGAGCGGCTGATATTCCTCGAGGAATATCAGCCGCTCGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081172
FRMPD1 MISSION shRNA Lentiviral Transduction Particles
FERM and PDZ domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081172.2-1082s21c1
Sequence:CCGGTCCAACTTTACTCCGAAATATCTCGAGATATTTCGGAGTAAAGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081172.2-3814s21c1
Sequence:CCGGGTGACGACAGTCCTATCATTTCTCGAGAAATGATAGGACTGTCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081172.2-2160s21c1
Sequence:CCGGAGCCGGACTGACTACTATAACCTCGAGGTTATAGTAGTCAGTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081172.2-1191s21c1
Sequence:CCGGGCTGCTCAGCTACGCTTAAATCTCGAGATTTAAGCGTAGCTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081172.2-394s21c1
Sequence:CCGGGTGAACGAGCGGCTGATATTCCTCGAGGAATATCAGCCGCTCGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks