EMAIL THIS PAGE TO A FRIEND

FRMPD2

FERM and PDZ domain containing 2

144 Gene Product Result for
Synonyms: PDZD5C PDZK4 PDZK5C
Gene ID:
Human(143162) Summary: This gene encodes a peripheral membrane protein and is located in a region of chromosome 10q that contains a segmental duplication. This copy of the gene is full-length and is in the telomeric duplicated region. Two other more centromerically proximal copies of the gene are partial and may represent pseudogenes. This full-length gene appears to function in the establishment and maintenance of cell polarization. The protein is recruited to cell-cell junctions in an E-cadherin-dependent manner, and is selectively localized at the basolateral membrane in polarized epithelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2009]
domestic guinea pig(100721411) FERM and PDZ domain containing 2
sheep(101115935) FERM and PDZ domain containing 2
Domestic Rabbit(100348282) FERM and PDZ domain containing 2
chicken(423777) FERM and PDZ domain containing 2
cow(520665) FERM and PDZ domain containing 2
Horse(100051923) FERM and PDZ domain containing 2
domestic cat(101088029) FERM and PDZ domain containing 2
dog(486768) FERM and PDZ domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152428 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152428 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152428 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017929 Rosetta Predictions human pricing
NM_001018071 Rosetta Predictions human pricing
NM_001042512 Rosetta Predictions human pricing
NM_152428 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210906 predicted 959
2 SASI_Hs01_00210909 predicted 1034
3 SASI_Hs02_00306815 predicted 575
4 SASI_Hs01_00210910 predicted 1051
5 SASI_Hs01_00210911 predicted 1155
6 SASI_Hs01_00210912 predicted 1172
7 SASI_Hs02_00306816 predicted 414
8 SASI_Hs02_00306817 predicted 1262
9 SASI_Hs01_00210913 predicted 1171
10 SASI_Hs01_00210914 predicted 766
11 SASI_Hs01_00210907 predicted 581
12 SASI_Hs01_00210908 predicted 1096
13 SASI_Hs01_00210915 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026742 predicted 3867
2 SASI_Hs01_00026745 predicted 3954
3 SASI_Hs02_00306962 predicted 3494
4 SASI_Hs01_00026746 predicted 3960
5 SASI_Hs01_00026747 predicted 4076
6 SASI_Hs01_00026748 predicted 4085
7 SASI_Hs02_00306963 predicted 3325
8 SASI_Hs02_00306964 predicted 4178
9 SASI_Hs01_00026749 predicted 4084
10 SASI_Hs01_00026750 predicted 3678
11 SASI_Hs01_00026743 predicted 3684
12 SASI_Hs01_00026744 predicted 4206
13 SASI_Hs01_00026751 predicted 4178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310258 predicted 946
2 SASI_Hs02_00310259 predicted 1027
3 SASI_Hs02_00310260 predicted 559
4 SASI_Hs02_00310261 predicted 1035
5 SASI_Hs02_00310262 predicted 1147
6 SASI_Hs02_00310263 predicted 1153
7 SASI_Hs02_00310264 predicted 395
8 SASI_Hs02_00310265 predicted 1247
9 SASI_Hs02_00310266 predicted 1154
10 SASI_Hs02_00310267 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222626 predicted 3806
2 SASI_Hs01_00222629 predicted 3883
3 SASI_Hs02_00366166 predicted 3422
4 SASI_Hs01_00222630 predicted 3901
5 SASI_Hs01_00222631 predicted 4005
6 SASI_Hs01_00222632 predicted 4020
7 SASI_Hs02_00366167 predicted 3256
8 SASI_Hs02_00366168 predicted 4110
9 SASI_Hs01_00222633 predicted 4022
10 SASI_Hs01_00222634 predicted 3605
11 SASI_Hs01_00222627 predicted 3355
12 SASI_Hs01_00222628 predicted 3875
13 SASI_Hs01_00222635 predicted 3850
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152428
FRMPD2 MISSION shRNA Bacterial Glycerol Stock
FERM and PDZ domain containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152428.4-1184s21c1
Sequence:CCGGCTACTTTGGCTTGGCGTATATCTCGAGATATACGCCAAGCCAAAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152428.4-1897s21c1
Sequence:CCGGATTCAGCCAAGACCAGTAAATCTCGAGATTTACTGGTCTTGGCTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152428.3-4119s1c1
Sequence:CCGGCGCATCTCTAAATAGGCAAATCTCGAGATTTGCCTATTTAGAGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152428.3-2066s1c1
Sequence:CCGGGCTGAGTACATCAATGGATAACTCGAGTTATCCATTGATGTACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152428.3-1928s1c1
Sequence:CCGGCCATGATAAGTTTGTGCAAATCTCGAGATTTGCACAAACTTATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152428.3-1215s1c1
Sequence:CCGGCCTCAGAAGACCTCCATGAATCTCGAGATTCATGGAGGTCTTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152428.3-3297s1c1
Sequence:CCGGGTGAGGATTAAGAGGCTCTTTCTCGAGAAAGAGCCTCTTAATCCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152428
FRMPD2 MISSION shRNA shRNA Plasmid DNA
FERM and PDZ domain containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152428.4-1184s21c1
Sequence:CCGGCTACTTTGGCTTGGCGTATATCTCGAGATATACGCCAAGCCAAAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152428.4-1897s21c1
Sequence:CCGGATTCAGCCAAGACCAGTAAATCTCGAGATTTACTGGTCTTGGCTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152428.3-4119s1c1
Sequence:CCGGCGCATCTCTAAATAGGCAAATCTCGAGATTTGCCTATTTAGAGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152428.3-2066s1c1
Sequence:CCGGGCTGAGTACATCAATGGATAACTCGAGTTATCCATTGATGTACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152428.3-1928s1c1
Sequence:CCGGCCATGATAAGTTTGTGCAAATCTCGAGATTTGCACAAACTTATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152428.3-1215s1c1
Sequence:CCGGCCTCAGAAGACCTCCATGAATCTCGAGATTCATGGAGGTCTTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152428.3-3297s1c1
Sequence:CCGGGTGAGGATTAAGAGGCTCTTTCTCGAGAAAGAGCCTCTTAATCCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152428
FRMPD2 MISSION shRNA Lentiviral Transduction Particles
FERM and PDZ domain containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152428.4-1184s21c1
Sequence:CCGGCTACTTTGGCTTGGCGTATATCTCGAGATATACGCCAAGCCAAAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152428.4-1897s21c1
Sequence:CCGGATTCAGCCAAGACCAGTAAATCTCGAGATTTACTGGTCTTGGCTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152428.3-4119s1c1
Sequence:CCGGCGCATCTCTAAATAGGCAAATCTCGAGATTTGCCTATTTAGAGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152428.3-2066s1c1
Sequence:CCGGGCTGAGTACATCAATGGATAACTCGAGTTATCCATTGATGTACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152428.3-1928s1c1
Sequence:CCGGCCATGATAAGTTTGTGCAAATCTCGAGATTTGCACAAACTTATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152428.3-1215s1c1
Sequence:CCGGCCTCAGAAGACCTCCATGAATCTCGAGATTCATGGAGGTCTTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152428.3-3297s1c1
Sequence:CCGGGTGAGGATTAAGAGGCTCTTTCTCGAGAAAGAGCCTCTTAATCCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)