EMAIL THIS PAGE TO A FRIEND

FRMPD2P1

FERM and PDZ domain containing 2 pseudogene 1

23 Gene Product Result for
Synonyms: FRMPD2L1 PDZD5A PDZK5A yX59F3.2
Species: Human FRMPD2P1(728798)
UniProtKB ID: Q6IN97, B2RPG2, Q5RJ30
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301268 ANTI-FRMPD2L2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001042524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042524 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042524 Rosetta Predictions human pricing
NM_001042525 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310348 predicted 954
2 SASI_Hs02_00310349 predicted 1034
3 SASI_Hs02_00310350 predicted 575
4 SASI_Hs02_00310351 predicted 1046
5 SASI_Hs02_00310352 predicted 1161
6 SASI_Hs02_00310353 predicted 1175
7 SASI_Hs02_00310354 predicted 415
8 SASI_Hs02_00310355 predicted 1167
9 SASI_Hs02_00310356 predicted 761
10 SASI_Hs02_00310357 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310358 predicted 944
2 SASI_Hs02_00310359 predicted 1026
3 SASI_Hs02_00310360 predicted 567
4 SASI_Hs02_00310361 predicted 1034
5 SASI_Hs02_00310362 predicted 1145
6 SASI_Hs02_00310363 predicted 1155
7 SASI_Hs02_00310364 predicted 403
8 SASI_Hs02_00310365 predicted 1160
9 SASI_Hs02_00310366 predicted 753
10 SASI_Hs02_00310367 predicted 1247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042524
FRMPD2P1 MISSION shRNA Bacterial Glycerol Stock
FERM and PDZ domain containing 2 pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042524.1-583s21c1
Sequence:CCGGACATTATCCTGGCCGTGAATGCTCGAGCATTCACGGCCAGGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042524.1-987s21c1
Sequence:CCGGGAAAGGGATGAATCAACATTGCTCGAGCAATGTTGATTCATCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042524.1-510s21c1
Sequence:CCGGAGTGATCTTGTGAGGATTAAGCTCGAGCTTAATCCTCACAAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042524.1-1099s21c1
Sequence:CCGGCCAGACTTTCGACAGATATTTCTCGAGAAATATCTGTCGAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042524.1-1334s21c1
Sequence:CCGGAGCTTGCCGCATCTCTAAATACTCGAGTATTTAGAGATGCGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042524
FRMPD2P1 MISSION shRNA shRNA Plasmid DNA
FERM and PDZ domain containing 2 pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042524.1-583s21c1
Sequence:CCGGACATTATCCTGGCCGTGAATGCTCGAGCATTCACGGCCAGGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042524.1-987s21c1
Sequence:CCGGGAAAGGGATGAATCAACATTGCTCGAGCAATGTTGATTCATCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042524.1-510s21c1
Sequence:CCGGAGTGATCTTGTGAGGATTAAGCTCGAGCTTAATCCTCACAAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042524.1-1099s21c1
Sequence:CCGGCCAGACTTTCGACAGATATTTCTCGAGAAATATCTGTCGAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042524.1-1334s21c1
Sequence:CCGGAGCTTGCCGCATCTCTAAATACTCGAGTATTTAGAGATGCGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042524
FRMPD2P1 MISSION shRNA Lentiviral Transduction Particles
FERM and PDZ domain containing 2 pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042524.1-583s21c1
Sequence:CCGGACATTATCCTGGCCGTGAATGCTCGAGCATTCACGGCCAGGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042524.1-987s21c1
Sequence:CCGGGAAAGGGATGAATCAACATTGCTCGAGCAATGTTGATTCATCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042524.1-510s21c1
Sequence:CCGGAGTGATCTTGTGAGGATTAAGCTCGAGCTTAATCCTCACAAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042524.1-1099s21c1
Sequence:CCGGCCAGACTTTCGACAGATATTTCTCGAGAAATATCTGTCGAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042524.1-1334s21c1
Sequence:CCGGAGCTTGCCGCATCTCTAAATACTCGAGTATTTAGAGATGCGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks