EMAIL THIS PAGE TO A FRIEND

FRMPD2P2

FERM and PDZ domain containing 2 pseudogene 2

Synonyms: FRMPD2L2 FRMPDP2 PDZD5B PDZK5B bA556L1.2
Species: Human FRMPD2P2(728603)
Gene ID:
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001042515 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042515 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042515 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042515 Rosetta Predictions human pricing
NM_001042516 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310268 predicted 962
2 SASI_Hs02_00310269 predicted 1036
3 SASI_Hs02_00310270 predicted 573
4 SASI_Hs02_00310271 predicted 1049
5 SASI_Hs02_00310272 predicted 1157
6 SASI_Hs02_00310273 predicted 1166
7 SASI_Hs02_00310274 predicted 415
8 SASI_Hs02_00310275 predicted 1176
9 SASI_Hs02_00310276 predicted 767
10 SASI_Hs02_00310277 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310278 predicted 946
2 SASI_Hs02_00310279 predicted 1018
3 SASI_Hs02_00310280 predicted 567
4 SASI_Hs02_00310281 predicted 1033
5 SASI_Hs02_00310282 predicted 1148
6 SASI_Hs02_00310283 predicted 1161
7 SASI_Hs02_00310284 predicted 401
8 SASI_Hs02_00310285 predicted 1159
9 SASI_Hs02_00310286 predicted 745
10 SASI_Hs02_00310287 predicted 1251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042515
FRMPD2P2 MISSION shRNA Bacterial Glycerol Stock
FERM and PDZ domain containing 2 pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042515.1-1061s21c1
Sequence:CCGGCATGAGACTTGGAAGATATTCCTCGAGGAATATCTTCCAAGTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042515.1-568s21c1
Sequence:CCGGCCATTGCAGCTGGTGACATTACTCGAGTAATGTCACCAGCTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042515.1-1642s21c1
Sequence:CCGGGGTTCCAAAGAAGTCAATAAACTCGAGTTTATTGACTTCTTTGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042515.1-1098s21c1
Sequence:CCGGACCAGACTTTCGACAGATATTCTCGAGAATATCTGTCGAAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042515.1-950s21c1
Sequence:CCGGTCCTGAGTCCCACCCTCATTTCTCGAGAAATGAGGGTGGGACTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042515
FRMPD2P2 MISSION shRNA shRNA Plasmid DNA
FERM and PDZ domain containing 2 pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042515.1-1061s21c1
Sequence:CCGGCATGAGACTTGGAAGATATTCCTCGAGGAATATCTTCCAAGTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042515.1-568s21c1
Sequence:CCGGCCATTGCAGCTGGTGACATTACTCGAGTAATGTCACCAGCTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042515.1-1642s21c1
Sequence:CCGGGGTTCCAAAGAAGTCAATAAACTCGAGTTTATTGACTTCTTTGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042515.1-1098s21c1
Sequence:CCGGACCAGACTTTCGACAGATATTCTCGAGAATATCTGTCGAAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042515.1-950s21c1
Sequence:CCGGTCCTGAGTCCCACCCTCATTTCTCGAGAAATGAGGGTGGGACTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042515
FRMPD2P2 MISSION shRNA Lentiviral Transduction Particles
FERM and PDZ domain containing 2 pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042515.1-1061s21c1
Sequence:CCGGCATGAGACTTGGAAGATATTCCTCGAGGAATATCTTCCAAGTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042515.1-568s21c1
Sequence:CCGGCCATTGCAGCTGGTGACATTACTCGAGTAATGTCACCAGCTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042515.1-1642s21c1
Sequence:CCGGGGTTCCAAAGAAGTCAATAAACTCGAGTTTATTGACTTCTTTGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042515.1-1098s21c1
Sequence:CCGGACCAGACTTTCGACAGATATTCTCGAGAATATCTGTCGAAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042515.1-950s21c1
Sequence:CCGGTCCTGAGTCCCACCCTCATTTCTCGAGAAATGAGGGTGGGACTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks