EMAIL THIS PAGE TO A FRIEND

FRMPD3

FERM and PDZ domain containing 3

62 Gene Product Result for
UniProtKB ID: Q5JV73, Q96JK8
Gene ID:
Mouse(245643) FERM and PDZ domain containing 3
Rat(678868) FERM and PDZ domain containing 3
chicken(428699) FERM and PDZ domain containing 3
dog(492056) FERM and PDZ domain containing 3
cow(517537) FERM and PDZ domain containing 3
domestic cat(101086458) FERM and PDZ domain containing 3
sheep(101115608) FERM and PDZ domain containing 3
domestic guinea pig(100725830) FERM and PDZ domain containing 3
naked mole-rat(101725745) FERM and PDZ domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122101 MISSION® esiRNA esiRNA human FRMPD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714381 Rosetta Predictions human pricing
XM_042978 Rosetta Predictions human pricing
XM_937007 Rosetta Predictions human pricing
XM_001053582 Rosetta Predictions rat pricing
NM_177750 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00396722 predicted 502
2 SASI_Hs02_00396723 predicted 1004
3 SASI_Hs02_00396724 predicted 1573
4 SASI_Hs02_00396725 predicted 3809
5 SASI_Hs02_00396726 predicted 255
6 SASI_Hs02_00396727 predicted 1330
7 SASI_Hs02_00396728 predicted 1544
8 SASI_Hs02_00396729 predicted 1258
9 SASI_Hs02_00396730 predicted 1998
10 SASI_Hs02_00396731 predicted 2655
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_042978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290327 predicted 857
2 SASI_Hs01_00290328 predicted 971
3 SASI_Hs01_00290330 predicted 598
4 SASI_Hs01_00290331 predicted 1065
5 SASI_Hs02_00478666 predicted 756
6 SASI_Hs01_00290333 predicted 4262
7 SASI_Hs01_00290334 predicted 277
8 SASI_Hs01_00290335 predicted 348
9 SASI_Hs01_00290336 predicted 1593
10 SASI_Hs02_00478667 predicted 1521
11 SASI_Hs01_00290329 predicted 441
12 SASI_Hs01_00290332 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482400 predicted 859
2 SASI_Hs02_00482401 predicted 971
3 SASI_Hs02_00482402 predicted 600
4 SASI_Hs02_00482403 predicted 1060
5 SASI_Hs02_00482404 predicted 749
6 SASI_Hs02_00482405 predicted 4264
7 SASI_Hs02_00482406 predicted 280
8 SASI_Hs02_00482407 predicted 353
9 SASI_Hs02_00482408 predicted 1591
10 SASI_Hs02_00482409 predicted 1519
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053582 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272859 predicted 1795
2 SASI_Rn02_00272860 predicted 4872
3 SASI_Rn02_00272861 predicted 758
4 SASI_Rn02_00272862 predicted 2879
5 SASI_Rn02_00272863 predicted 727
6 SASI_Rn02_00272864 predicted 3245
7 SASI_Rn02_00272865 predicted 4247
8 SASI_Rn02_00272866 predicted 836
9 SASI_Rn02_00272867 predicted 2193
10 SASI_Rn02_00272868 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091891 predicted 2553
2 SASI_Mm01_00091892 predicted 2639
3 SASI_Mm01_00091893 predicted 2390
4 SASI_Mm01_00091894 predicted 2289
5 SASI_Mm01_00091895 predicted 2790
6 SASI_Mm01_00091896 predicted 2817
7 SASI_Mm01_00091897 predicted 2564
8 SASI_Mm01_00091898 predicted 2659
9 SASI_Mm01_00091899 predicted 2286
10 SASI_Mm01_00091900 predicted 2790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177750
FRMPD3 MISSION shRNA Bacterial Glycerol Stock
FERM and PDZ domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177750.2-2233s1c1
Sequence:CCGGGACCACTGTTAAGGATGTGATCTCGAGATCACATCCTTAACAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176741    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177750.2-2557s1c1
Sequence:CCGGCCATCACAATGAAGTTACTATCTCGAGATAGTAACTTCATTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177750.2-2645s1c1
Sequence:CCGGGACTTGAATTTGATGGTCAAACTCGAGTTTGACCATCAAATTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177750.2-2391s1c1
Sequence:CCGGCACACTACCATGGAATGAAATCTCGAGATTTCATTCCATGGTAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177750.2-2750s1c1
Sequence:CCGGCCAAGGTTTGACAAGTTCTTTCTCGAGAAAGAACTTGTCAAACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177750
FRMPD3 MISSION shRNA shRNA Plasmid DNA
FERM and PDZ domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177750.2-2233s1c1
Sequence:CCGGGACCACTGTTAAGGATGTGATCTCGAGATCACATCCTTAACAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176741    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177750.2-2557s1c1
Sequence:CCGGCCATCACAATGAAGTTACTATCTCGAGATAGTAACTTCATTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177750.2-2645s1c1
Sequence:CCGGGACTTGAATTTGATGGTCAAACTCGAGTTTGACCATCAAATTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177750.2-2391s1c1
Sequence:CCGGCACACTACCATGGAATGAAATCTCGAGATTTCATTCCATGGTAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177750.2-2750s1c1
Sequence:CCGGCCAAGGTTTGACAAGTTCTTTCTCGAGAAAGAACTTGTCAAACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177750
FRMPD3 MISSION shRNA Lentiviral Transduction Particles
FERM and PDZ domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177750.2-2233s1c1
Sequence:CCGGGACCACTGTTAAGGATGTGATCTCGAGATCACATCCTTAACAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176741    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177750.2-2557s1c1
Sequence:CCGGCCATCACAATGAAGTTACTATCTCGAGATAGTAACTTCATTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177750.2-2645s1c1
Sequence:CCGGGACTTGAATTTGATGGTCAAACTCGAGTTTGACCATCAAATTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177750.2-2391s1c1
Sequence:CCGGCACACTACCATGGAATGAAATCTCGAGATTTCATTCCATGGTAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177750.2-2750s1c1
Sequence:CCGGCCAAGGTTTGACAAGTTCTTTCTCGAGAAAGAACTTGTCAAACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks