EMAIL THIS PAGE TO A FRIEND

FRMPD4

FERM and PDZ domain containing 4

165 Gene Product Result for
Synonyms: PDZD10 PDZK10
UniProtKB ID: Q14CM0, A8K0X9, O15032
Gene ID:
Human(9758) Summary: This gene encodes a multi-domain (WW, PDZ, FERM) containing protein. Through its interaction with other proteins (such as PSD-95), it functions as a positive regulator of dendritic spine morphogenesis and density, and is required for the maintenance of excitatory synaptic transmission. [provided by RefSeq, Jan 2010]
Mouse(333605) FERM and PDZ domain containing 4
Rat(302656) FERM and PDZ domain containing 4
Zebrafish(403129) FERM and PDZ domain containing 4
cow(509589) FERM and PDZ domain containing 4
Horse(100050197) FERM and PDZ domain containing 4
domestic cat(101086538) FERM and PDZ domain containing 4
dog(611238) FERM and PDZ domain containing 4
chicken(418640) FERM and PDZ domain containing 4
naked mole-rat(101698105) FERM and PDZ domain containing 4
domestic guinea pig(100715845) FERM and PDZ domain containing 4
sheep(101119442) FERM and PDZ domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014728 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033330 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033330 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033330 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014728 Rosetta Predictions human pricing
NM_001106960 Rosetta Predictions rat pricing
NM_001033330 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015898 predicted 1013
2 SASI_Hs01_00015899 predicted 1678
3 SASI_Hs01_00015901 predicted 3510
4 SASI_Hs01_00015902 predicted 3784
5 SASI_Hs02_00346171 predicted 3778
6 SASI_Hs01_00015903 predicted 2478
7 SASI_Hs01_00015904 predicted 2891
8 SASI_Hs01_00015905 predicted 2468
9 SASI_Hs01_00015906 predicted 2304
10 SASI_Hs02_00346172 predicted 3185
11 SASI_Hs01_00015897 predicted 1646
12 SASI_Hs01_00015900 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224106 predicted 2043
2 SASI_Rn02_00224107 predicted 1014
3 SASI_Rn02_00224108 predicted 3384
4 SASI_Rn02_00224109 predicted 2160
5 SASI_Rn02_00224110 predicted 1172
6 SASI_Rn02_00224111 predicted 4734
7 SASI_Rn02_00224112 predicted 4265
8 SASI_Rn02_00224113 predicted 668
9 SASI_Rn02_00224114 predicted 3930
10 SASI_Rn02_00224115 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059480 predicted 1827
2 SASI_Mm01_00059481 predicted 4198
3 SASI_Mm02_00288573 predicted 1157
4 SASI_Mm01_00059482 predicted 1984
5 SASI_Mm01_00059483 predicted 2278
6 SASI_Mm01_00059484 predicted 2983
7 SASI_Mm01_00059485 predicted 1234
8 SASI_Mm01_00059487 predicted 1588
9 SASI_Mm02_00288574 predicted 3036
10 SASI_Mm02_00288575 predicted 3653
11 SASI_Mm01_00059478 predicted 1009
12 SASI_Mm01_00059479 predicted 2856
13 SASI_Mm01_00059486 predicted 932
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014728
FRMPD4 MISSION shRNA Bacterial Glycerol Stock
FERM and PDZ domain containing 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014728.1-1901s1c1
Sequence:CCGGCCACGTCAACAGGATCGAAATCTCGAGATTTCGATCCTGTTGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014728.1-5291s1c1
Sequence:CCGGGCCCTAAAGGAGAGCACATATCTCGAGATATGTGCTCTCCTTTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014728.1-1361s1c1
Sequence:CCGGCCGAATTAGCTTCGTCCCAAACTCGAGTTTGGGACGAAGCTAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014728.1-1449s1c1
Sequence:CCGGGATGTGGTTCAGGAGCGATTTCTCGAGAAATCGCTCCTGAACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014728.1-2446s1c1
Sequence:CCGGGAGGAGCTAAAGTGTCCTTTACTCGAGTAAAGGACACTTTAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014728.1-5578s1c1
Sequence:CCGGGCGATTAGTTAAAGTCGTGAACTCGAGTTCACGACTTTAACTAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014728.1-985s1c1
Sequence:CCGGCAGCATTTATTAGTGCTGCAACTCGAGTTGCAGCACTAATAAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014728.1-1145s1c1
Sequence:CCGGGCAGACCAAATCATTTCGTTTCTCGAGAAACGAAATGATTTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014728.1-2205s1c1
Sequence:CCGGGAAGCCCAGATAACATACATACTCGAGTATGTATGTTATCTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014728.1-3500s1c1
Sequence:CCGGGCCTGAAACTATGGAGACTAACTCGAGTTAGTCTCCATAGTTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014728
FRMPD4 MISSION shRNA shRNA Plasmid DNA
FERM and PDZ domain containing 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014728.1-1901s1c1
Sequence:CCGGCCACGTCAACAGGATCGAAATCTCGAGATTTCGATCCTGTTGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014728.1-5291s1c1
Sequence:CCGGGCCCTAAAGGAGAGCACATATCTCGAGATATGTGCTCTCCTTTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014728.1-1361s1c1
Sequence:CCGGCCGAATTAGCTTCGTCCCAAACTCGAGTTTGGGACGAAGCTAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014728.1-1449s1c1
Sequence:CCGGGATGTGGTTCAGGAGCGATTTCTCGAGAAATCGCTCCTGAACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014728.1-2446s1c1
Sequence:CCGGGAGGAGCTAAAGTGTCCTTTACTCGAGTAAAGGACACTTTAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014728.1-5578s1c1
Sequence:CCGGGCGATTAGTTAAAGTCGTGAACTCGAGTTCACGACTTTAACTAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014728.1-985s1c1
Sequence:CCGGCAGCATTTATTAGTGCTGCAACTCGAGTTGCAGCACTAATAAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014728.1-1145s1c1
Sequence:CCGGGCAGACCAAATCATTTCGTTTCTCGAGAAACGAAATGATTTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014728.1-2205s1c1
Sequence:CCGGGAAGCCCAGATAACATACATACTCGAGTATGTATGTTATCTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014728.1-3500s1c1
Sequence:CCGGGCCTGAAACTATGGAGACTAACTCGAGTTAGTCTCCATAGTTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014728
FRMPD4 MISSION shRNA Lentiviral Transduction Particles
FERM and PDZ domain containing 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014728.1-1901s1c1
Sequence:CCGGCCACGTCAACAGGATCGAAATCTCGAGATTTCGATCCTGTTGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014728.1-5291s1c1
Sequence:CCGGGCCCTAAAGGAGAGCACATATCTCGAGATATGTGCTCTCCTTTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014728.1-1361s1c1
Sequence:CCGGCCGAATTAGCTTCGTCCCAAACTCGAGTTTGGGACGAAGCTAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014728.1-1449s1c1
Sequence:CCGGGATGTGGTTCAGGAGCGATTTCTCGAGAAATCGCTCCTGAACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014728.1-2446s1c1
Sequence:CCGGGAGGAGCTAAAGTGTCCTTTACTCGAGTAAAGGACACTTTAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014728.1-5578s1c1
Sequence:CCGGGCGATTAGTTAAAGTCGTGAACTCGAGTTCACGACTTTAACTAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014728.1-985s1c1
Sequence:CCGGCAGCATTTATTAGTGCTGCAACTCGAGTTGCAGCACTAATAAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014728.1-1145s1c1
Sequence:CCGGGCAGACCAAATCATTTCGTTTCTCGAGAAACGAAATGATTTGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014728.1-2205s1c1
Sequence:CCGGGAAGCCCAGATAACATACATACTCGAGTATGTATGTTATCTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014728.1-3500s1c1
Sequence:CCGGGCCTGAAACTATGGAGACTAACTCGAGTTAGTCTCCATAGTTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033330
FRMPD4 MISSION shRNA Bacterial Glycerol Stock
FERM and PDZ domain containing 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033330.2-1601s21c1
Sequence:CCGGATGTCGTTCAGGAGCGATTTGCTCGAGCAAATCGCTCCTGAACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033330.2-6786s21c1
Sequence:CCGGCATAAACCGAAGGCATTATTTCTCGAGAAATAATGCCTTCGGTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033330.2-1895s21c1
Sequence:CCGGTCAGCGACCTGCGACTATATGCTCGAGCATATAGTCGCAGGTCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033330.2-2203s21c1
Sequence:CCGGGTGGACTCCAGGAGGTCAATACTCGAGTATTGACCTCCTGGAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033330.2-4215s21c1
Sequence:CCGGCCGCCTTTGTGACTACCATTTCTCGAGAAATGGTAGTCACAAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033330
FRMPD4 MISSION shRNA shRNA Plasmid DNA
FERM and PDZ domain containing 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033330.2-1601s21c1
Sequence:CCGGATGTCGTTCAGGAGCGATTTGCTCGAGCAAATCGCTCCTGAACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033330.2-6786s21c1
Sequence:CCGGCATAAACCGAAGGCATTATTTCTCGAGAAATAATGCCTTCGGTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033330.2-1895s21c1
Sequence:CCGGTCAGCGACCTGCGACTATATGCTCGAGCATATAGTCGCAGGTCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033330.2-2203s21c1
Sequence:CCGGGTGGACTCCAGGAGGTCAATACTCGAGTATTGACCTCCTGGAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033330.2-4215s21c1
Sequence:CCGGCCGCCTTTGTGACTACCATTTCTCGAGAAATGGTAGTCACAAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033330
FRMPD4 MISSION shRNA Lentiviral Transduction Particles
FERM and PDZ domain containing 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033330.2-1601s21c1
Sequence:CCGGATGTCGTTCAGGAGCGATTTGCTCGAGCAAATCGCTCCTGAACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033330.2-6786s21c1
Sequence:CCGGCATAAACCGAAGGCATTATTTCTCGAGAAATAATGCCTTCGGTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033330.2-1895s21c1
Sequence:CCGGTCAGCGACCTGCGACTATATGCTCGAGCATATAGTCGCAGGTCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033330.2-2203s21c1
Sequence:CCGGGTGGACTCCAGGAGGTCAATACTCGAGTATTGACCTCCTGGAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033330.2-4215s21c1
Sequence:CCGGCCGCCTTTGTGACTACCATTTCTCGAGAAATGGTAGTCACAAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks