EMAIL THIS PAGE TO A FRIEND

FRRS1

ferric-chelate reductase 1

70 Gene Product Result for
Synonyms: SDFR2 SDR2
UniProtKB ID: Q6ZNA5, A6NLN7
Gene ID:
Human(391059) Summary: Members of the cytochrome b561 (CYB561; MIM 600019) family, including FRRS1, reduce ferric to ferrous iron before its transport from the endosome to the cytoplasm (Vargas et al., 2003 [PubMed 14499595]
Mouse(20321) ferric-chelate reductase 1
Rat(310810) ferric-chelate reductase 1
chicken(429082) ferric-chelate reductase 1
dog(490144) ferric-chelate reductase 1
Horse(100056263) ferric-chelate reductase 1
domestic cat(101085818) ferric-chelate reductase 1
cow(516522) ferric-chelate reductase 1
sheep(101111238) ferric-chelate reductase 1
Domestic Rabbit(100348756) ferric-chelate reductase 1
domestic guinea pig(100730138) ferric-chelate reductase 1
naked mole-rat(101716727) ferric-chelate reductase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA017883 Anti-FRRS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009146 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009146 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009146 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001013660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013660 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013660 Rosetta Predictions human pricing
XM_001073918 Rosetta Predictions rat pricing
XM_227622 Rosetta Predictions rat pricing
NM_001113478 Rosetta Predictions mouse pricing
NM_009146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236571 predicted 1431
2 SASI_Hs02_00306432 predicted 1012
3 SASI_Hs02_00306433 predicted 2015
4 SASI_Hs01_00236573 predicted 867
5 SASI_Hs01_00236574 predicted 2095
6 SASI_Hs02_00306434 predicted 1127
7 SASI_Hs01_00236576 predicted 1717
8 SASI_Hs02_00306435 predicted 2084
9 SASI_Hs01_00236578 predicted 1741
10 SASI_Hs01_00236579 predicted 1594
11 SASI_Hs01_00236572 predicted 1500
12 SASI_Hs01_00236575 predicted 2246
13 SASI_Hs01_00236577 predicted 1560
14 SASI_Hs01_00236580 predicted 1570
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073918 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344387 predicted 859
2 SASI_Rn02_00344388 predicted 1140
3 SASI_Rn02_00344389 predicted 987
4 SASI_Rn02_00344390 predicted 789
5 SASI_Rn02_00344391 predicted 496
6 SASI_Rn02_00344392 predicted 1151
7 SASI_Rn02_00344393 predicted 979
8 SASI_Rn02_00344394 predicted 928
9 SASI_Rn02_00344395 predicted 248
10 SASI_Rn02_00344396 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227622 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384562 predicted 858
2 SASI_Rn02_00384563 predicted 1136
3 SASI_Rn02_00384564 predicted 989
4 SASI_Rn02_00384565 predicted 793
5 SASI_Rn02_00384566 predicted 489
6 SASI_Rn02_00384567 predicted 1147
7 SASI_Rn02_00384568 predicted 972
8 SASI_Rn02_00384569 predicted 930
9 SASI_Rn02_00384570 predicted 245
10 SASI_Rn02_00384571 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307973 predicted 1599
2 SASI_Mm02_00307974 predicted 1010
3 SASI_Mm02_00307975 predicted 771
4 SASI_Mm02_00307976 predicted 1292
5 SASI_Mm02_00307977 predicted 587
6 SASI_Mm02_00307978 predicted 977
7 SASI_Mm02_00307979 predicted 474
8 SASI_Mm02_00307980 predicted 1134
9 SASI_Mm02_00307981 predicted 653
10 SASI_Mm02_00307982 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028811 predicted 1566
2 SASI_Mm01_00028812 predicted 970
3 SASI_Mm01_00028813 predicted 739
4 SASI_Mm01_00028814 predicted 1254
5 SASI_Mm01_00028815 predicted 554
6 SASI_Mm02_00315459 predicted 944
7 SASI_Mm02_00315460 predicted 440
8 SASI_Mm01_00028817 predicted 1096
9 SASI_Mm01_00028818 predicted 611
10 SASI_Mm01_00028819 predicted 343
11 SASI_Mm01_00028816 predicted 1630
12 SASI_Mm01_00028820 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009146
VALIDATED
FRRS1 MISSION shRNA Bacterial Glycerol Stock
ferric-chelate reductase 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-298s21c1
Sequence:CCGGTGAGTCAGACGACGTTCAAACCTCGAGGTTTGAACGTCGTCTGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-1775s21c1
Sequence:CCGGGGACAACGATAGGATTCAAATCTCGAGATTTGAATCCTATCGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009146.3-1136s21c1
Sequence:CCGGGTCTCACGACGGCCGAATATTCTCGAGAATATTCGGCCGTCGTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-2170s21c1
Sequence:CCGGAGCATCTCATGCCAGATTTAACTCGAGTTAAATCTGGCATGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-324s21c1
Sequence:CCGGGACCAGATCAAAGTTACTTTACTCGAGTAAAGTAACTTTGATCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-607s21c1
Sequence:CCGGAGATTCCGAGTCCCGTAATTTCTCGAGAAATTACGGGACTCGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-1167s21c1
Sequence:CCGGCAGCAACCTTTGATAACATATCTCGAGATATGTTATCAAAGGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-1955s21c1
Sequence:CCGGCCTGGGTCATGATGATCATTACTCGAGTAATGATCATCATGACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009146.1-2068s1c1
Sequence:CCGGGCTCACATTCAAGTGGGCTAACTCGAGTTAGCCCACTTGAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009146.1-606s1c1
Sequence:CCGGCCCGTAATTTCCCAACCAAATCTCGAGATTTGGTTGGGAAATTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009146.1-1022s1c1
Sequence:CCGGCGGCGTCATACAGTGTTCATTCTCGAGAATGAACACTGTATGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009146.1-1842s1c1
Sequence:CCGGGCCGTTTACATATGTGGGAATCTCGAGATTCCCACATATGTAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009146.1-604s1c1
Sequence:CCGGGTCCCGTAATTTCCCAACCAACTCGAGTTGGTTGGGAAATTACGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009146
VALIDATED
FRRS1 MISSION shRNA shRNA Plasmid DNA
ferric-chelate reductase 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-298s21c1
Sequence:CCGGTGAGTCAGACGACGTTCAAACCTCGAGGTTTGAACGTCGTCTGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-1775s21c1
Sequence:CCGGGGACAACGATAGGATTCAAATCTCGAGATTTGAATCCTATCGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009146.3-1136s21c1
Sequence:CCGGGTCTCACGACGGCCGAATATTCTCGAGAATATTCGGCCGTCGTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-2170s21c1
Sequence:CCGGAGCATCTCATGCCAGATTTAACTCGAGTTAAATCTGGCATGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-324s21c1
Sequence:CCGGGACCAGATCAAAGTTACTTTACTCGAGTAAAGTAACTTTGATCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-607s21c1
Sequence:CCGGAGATTCCGAGTCCCGTAATTTCTCGAGAAATTACGGGACTCGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-1167s21c1
Sequence:CCGGCAGCAACCTTTGATAACATATCTCGAGATATGTTATCAAAGGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-1955s21c1
Sequence:CCGGCCTGGGTCATGATGATCATTACTCGAGTAATGATCATCATGACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009146.1-2068s1c1
Sequence:CCGGGCTCACATTCAAGTGGGCTAACTCGAGTTAGCCCACTTGAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009146.1-606s1c1
Sequence:CCGGCCCGTAATTTCCCAACCAAATCTCGAGATTTGGTTGGGAAATTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009146.1-1022s1c1
Sequence:CCGGCGGCGTCATACAGTGTTCATTCTCGAGAATGAACACTGTATGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009146.1-1842s1c1
Sequence:CCGGGCCGTTTACATATGTGGGAATCTCGAGATTCCCACATATGTAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009146.1-604s1c1
Sequence:CCGGGTCCCGTAATTTCCCAACCAACTCGAGTTGGTTGGGAAATTACGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009146
VALIDATED
FRRS1 MISSION shRNA Lentiviral Transduction Particles
ferric-chelate reductase 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-298s21c1
Sequence:CCGGTGAGTCAGACGACGTTCAAACCTCGAGGTTTGAACGTCGTCTGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-1775s21c1
Sequence:CCGGGGACAACGATAGGATTCAAATCTCGAGATTTGAATCCTATCGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009146.3-1136s21c1
Sequence:CCGGGTCTCACGACGGCCGAATATTCTCGAGAATATTCGGCCGTCGTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-2170s21c1
Sequence:CCGGAGCATCTCATGCCAGATTTAACTCGAGTTAAATCTGGCATGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-324s21c1
Sequence:CCGGGACCAGATCAAAGTTACTTTACTCGAGTAAAGTAACTTTGATCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-607s21c1
Sequence:CCGGAGATTCCGAGTCCCGTAATTTCTCGAGAAATTACGGGACTCGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-1167s21c1
Sequence:CCGGCAGCAACCTTTGATAACATATCTCGAGATATGTTATCAAAGGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009146.3-1955s21c1
Sequence:CCGGCCTGGGTCATGATGATCATTACTCGAGTAATGATCATCATGACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009146.1-2068s1c1
Sequence:CCGGGCTCACATTCAAGTGGGCTAACTCGAGTTAGCCCACTTGAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009146.1-606s1c1
Sequence:CCGGCCCGTAATTTCCCAACCAAATCTCGAGATTTGGTTGGGAAATTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009146.1-1022s1c1
Sequence:CCGGCGGCGTCATACAGTGTTCATTCTCGAGAATGAACACTGTATGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009146.1-1842s1c1
Sequence:CCGGGCCGTTTACATATGTGGGAATCTCGAGATTCCCACATATGTAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009146.1-604s1c1
Sequence:CCGGGTCCCGTAATTTCCCAACCAACTCGAGTTGGTTGGGAAATTACGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013660
FRRS1 MISSION shRNA Bacterial Glycerol Stock
ferric-chelate reductase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013660.2-1069s21c1
Sequence:CCGGAGATTCCTGGTCCTATAATTTCTCGAGAAATTATAGGACCAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013660.2-1556s21c1
Sequence:CCGGTGATCTAAACACAAGCTATTACTCGAGTAATAGCTTGTGTTTAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013660.2-1151s21c1
Sequence:CCGGACCTCCCGTTTCCCACTTAACCTCGAGGTTAAGTGGGAAACGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013660.2-2425s21c1
Sequence:CCGGCTGACTGCCTGGAGCATATTTCTCGAGAAATATGCTCCAGGCAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013660.2-2488s21c1
Sequence:CCGGATTCTGAAGTCCAGCCTTTAGCTCGAGCTAAAGGCTGGACTTCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013660.1-2498s1c1
Sequence:CCGGCCAGCCTTTAGAGAACAACATCTCGAGATGTTGTTCTCTAAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013660.1-1596s1c1
Sequence:CCGGGCAGCTAATGATGGTCGAATTCTCGAGAATTCGACCATCATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013660.1-647s1c1
Sequence:CCGGGCACATTAGTTATGTGGCTAACTCGAGTTAGCCACATAACTAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013660.1-1949s1c1
Sequence:CCGGCGGCTGTATAGTGATGACTTTCTCGAGAAAGTCATCACTATACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013660
FRRS1 MISSION shRNA shRNA Plasmid DNA
ferric-chelate reductase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013660.2-1069s21c1
Sequence:CCGGAGATTCCTGGTCCTATAATTTCTCGAGAAATTATAGGACCAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013660.2-1556s21c1
Sequence:CCGGTGATCTAAACACAAGCTATTACTCGAGTAATAGCTTGTGTTTAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013660.2-1151s21c1
Sequence:CCGGACCTCCCGTTTCCCACTTAACCTCGAGGTTAAGTGGGAAACGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013660.2-2425s21c1
Sequence:CCGGCTGACTGCCTGGAGCATATTTCTCGAGAAATATGCTCCAGGCAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013660.2-2488s21c1
Sequence:CCGGATTCTGAAGTCCAGCCTTTAGCTCGAGCTAAAGGCTGGACTTCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013660.1-2498s1c1
Sequence:CCGGCCAGCCTTTAGAGAACAACATCTCGAGATGTTGTTCTCTAAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013660.1-1596s1c1
Sequence:CCGGGCAGCTAATGATGGTCGAATTCTCGAGAATTCGACCATCATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013660.1-647s1c1
Sequence:CCGGGCACATTAGTTATGTGGCTAACTCGAGTTAGCCACATAACTAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013660.1-1949s1c1
Sequence:CCGGCGGCTGTATAGTGATGACTTTCTCGAGAAAGTCATCACTATACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013660
FRRS1 MISSION shRNA Lentiviral Transduction Particles
ferric-chelate reductase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013660.2-1069s21c1
Sequence:CCGGAGATTCCTGGTCCTATAATTTCTCGAGAAATTATAGGACCAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013660.2-1556s21c1
Sequence:CCGGTGATCTAAACACAAGCTATTACTCGAGTAATAGCTTGTGTTTAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013660.2-1151s21c1
Sequence:CCGGACCTCCCGTTTCCCACTTAACCTCGAGGTTAAGTGGGAAACGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013660.2-2425s21c1
Sequence:CCGGCTGACTGCCTGGAGCATATTTCTCGAGAAATATGCTCCAGGCAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013660.2-2488s21c1
Sequence:CCGGATTCTGAAGTCCAGCCTTTAGCTCGAGCTAAAGGCTGGACTTCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013660.1-2498s1c1
Sequence:CCGGCCAGCCTTTAGAGAACAACATCTCGAGATGTTGTTCTCTAAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013660.1-1596s1c1
Sequence:CCGGGCAGCTAATGATGGTCGAATTCTCGAGAATTCGACCATCATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013660.1-647s1c1
Sequence:CCGGGCACATTAGTTATGTGGCTAACTCGAGTTAGCCACATAACTAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013660.1-1949s1c1
Sequence:CCGGCGGCTGTATAGTGATGACTTTCTCGAGAAAGTCATCACTATACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks