EMAIL THIS PAGE TO A FRIEND

FRRS1L

ferric-chelate reductase 1-like

64 Gene Product Result for
Synonyms: C9orf4 CG-6 CG6
UniProtKB ID: Q9P0K9, Q5T4G4
Gene ID:
Mouse(230235) ferric-chelate reductase 1 like
Rat(366376) ferric-chelate reductase 1-like
dog(612466) ferric-chelate reductase 1-like
cow(538492) ferric-chelate reductase 1-like
domestic cat(101089656) ferric-chelate reductase 1-like
naked mole-rat(101713456) ferric-chelate reductase 1-like
domestic guinea pig(100713336) ferric-chelate reductase 1-like
sheep(101123190) ferric-chelate reductase 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014334 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001142965 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001142965 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001142965 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014334 Rosetta Predictions human pricing
XM_345535 Rosetta Predictions rat pricing
XR_001563 Rosetta Predictions mouse pricing
XR_001596 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150388 predicted 568
2 SASI_Hs02_00345467 predicted 659
3 SASI_Hs01_00150389 predicted 506
4 SASI_Hs01_00150390 predicted 581
5 SASI_Hs01_00150392 predicted 805
6 SASI_Hs01_00150393 predicted 659
7 SASI_Hs02_00345468 predicted 654
8 SASI_Hs02_00345469 predicted 855
9 SASI_Hs02_00345470 predicted 789
10 SASI_Hs01_00150394 predicted 567
11 SASI_Hs01_00150391 predicted 854
12 SASI_Hs01_00150395 predicted 669
13 SASI_Hs01_00150396 predicted 656
14 SASI_Hs01_00150397 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398476 predicted 768
2 SASI_Rn02_00398477 predicted 850
3 SASI_Rn02_00398478 predicted 889
4 SASI_Rn02_00398479 predicted 884
5 SASI_Rn02_00398480 predicted 770
6 SASI_Rn02_00398481 predicted 742
7 SASI_Rn02_00398482 predicted 849
8 SASI_Rn02_00398483 predicted 890
9 SASI_Rn02_00398484 predicted 874
10 SASI_Rn02_00398485 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_001563 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00452055 predicted 471
2 SASI_Mm02_00452056 predicted 679
3 SASI_Mm02_00452057 predicted 765
4 SASI_Mm02_00452058 predicted 752
5 SASI_Mm02_00452059 predicted 852
6 SASI_Mm02_00452060 predicted 562
7 SASI_Mm02_00452061 predicted 852
8 SASI_Mm02_00452062 predicted 477
9 SASI_Mm02_00452063 predicted 648
10 SASI_Mm02_00452064 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_001596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00452205 predicted 473
2 SASI_Mm02_00452206 predicted 679
3 SASI_Mm02_00452207 predicted 765
4 SASI_Mm02_00452208 predicted 756
5 SASI_Mm02_00452209 predicted 848
6 SASI_Mm02_00452210 predicted 559
7 SASI_Mm02_00452211 predicted 854
8 SASI_Mm02_00452212 predicted 474
9 SASI_Mm02_00452213 predicted 647
10 SASI_Mm02_00452214 predicted 882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014334
FRRS1L MISSION shRNA Bacterial Glycerol Stock
ferric-chelate reductase 1-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014334.1-952s1c1
Sequence:CCGGGCTGCCTATCAAACCTTCTCACTCGAGTGAGAAGGTTTGATAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014334.1-902s1c1
Sequence:CCGGCAGAGCGTGTTGTCAGTATTTCTCGAGAAATACTGACAACACGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014334.1-906s1c1
Sequence:CCGGGCGTGTTGTCAGTATTTACAACTCGAGTTGTAAATACTGACAACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014334.1-961s1c1
Sequence:CCGGCAAACCTTCTCATCTCCATTTCTCGAGAAATGGAGATGAGAAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014334.1-953s1c1
Sequence:CCGGCTGCCTATCAAACCTTCTCATCTCGAGATGAGAAGGTTTGATAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014334.1-722s1c1
Sequence:CCGGCCAGAGATGAAGAAGGAGTTTCTCGAGAAACTCCTTCTTCATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014334.1-778s1c1
Sequence:CCGGCCTGTGAATGTTCCCAGAGATCTCGAGATCTCTGGGAACATTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014334.2-499s21c1
Sequence:CCGGGCAGAGACCTGTGACTATTTCCTCGAGGAAATAGTCACAGGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014334
FRRS1L MISSION shRNA shRNA Plasmid DNA
ferric-chelate reductase 1-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014334.1-952s1c1
Sequence:CCGGGCTGCCTATCAAACCTTCTCACTCGAGTGAGAAGGTTTGATAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014334.1-902s1c1
Sequence:CCGGCAGAGCGTGTTGTCAGTATTTCTCGAGAAATACTGACAACACGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014334.1-906s1c1
Sequence:CCGGGCGTGTTGTCAGTATTTACAACTCGAGTTGTAAATACTGACAACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014334.1-961s1c1
Sequence:CCGGCAAACCTTCTCATCTCCATTTCTCGAGAAATGGAGATGAGAAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014334.1-953s1c1
Sequence:CCGGCTGCCTATCAAACCTTCTCATCTCGAGATGAGAAGGTTTGATAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014334.1-722s1c1
Sequence:CCGGCCAGAGATGAAGAAGGAGTTTCTCGAGAAACTCCTTCTTCATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014334.1-778s1c1
Sequence:CCGGCCTGTGAATGTTCCCAGAGATCTCGAGATCTCTGGGAACATTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014334.2-499s21c1
Sequence:CCGGGCAGAGACCTGTGACTATTTCCTCGAGGAAATAGTCACAGGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014334
FRRS1L MISSION shRNA Lentiviral Transduction Particles
ferric-chelate reductase 1-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014334.1-952s1c1
Sequence:CCGGGCTGCCTATCAAACCTTCTCACTCGAGTGAGAAGGTTTGATAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014334.1-902s1c1
Sequence:CCGGCAGAGCGTGTTGTCAGTATTTCTCGAGAAATACTGACAACACGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014334.1-906s1c1
Sequence:CCGGGCGTGTTGTCAGTATTTACAACTCGAGTTGTAAATACTGACAACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014334.1-961s1c1
Sequence:CCGGCAAACCTTCTCATCTCCATTTCTCGAGAAATGGAGATGAGAAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014334.1-953s1c1
Sequence:CCGGCTGCCTATCAAACCTTCTCATCTCGAGATGAGAAGGTTTGATAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014334.1-722s1c1
Sequence:CCGGCCAGAGATGAAGAAGGAGTTTCTCGAGAAACTCCTTCTTCATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014334.1-778s1c1
Sequence:CCGGCCTGTGAATGTTCCCAGAGATCTCGAGATCTCTGGGAACATTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014334.2-499s21c1
Sequence:CCGGGCAGAGACCTGTGACTATTTCCTCGAGGAAATAGTCACAGGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001142965
FRRS1L MISSION shRNA Bacterial Glycerol Stock
ferric-chelate reductase 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142965.1-631s21c1
Sequence:CCGGCGCATACAGCACTTCTATAATCTCGAGATTATAGAAGTGCTGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142965.1-734s21c1
Sequence:CCGGGGTTTAAGCGTCCCGTGAATGCTCGAGCATTCACGGGACGCTTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142965.1-485s21c1
Sequence:CCGGTCCTTAGCTACCGGATGATAGCTCGAGCTATCATCCGGTAGCTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142965.1-833s21c1
Sequence:CCGGCCATCACTCGTCACGACATAGCTCGAGCTATGTCGTGACGAGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142965.1-3124s21c1
Sequence:CCGGATAGTCTACCCGACGAGTAATCTCGAGATTACTCGTCGGGTAGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001142965
FRRS1L MISSION shRNA shRNA Plasmid DNA
ferric-chelate reductase 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142965.1-631s21c1
Sequence:CCGGCGCATACAGCACTTCTATAATCTCGAGATTATAGAAGTGCTGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142965.1-734s21c1
Sequence:CCGGGGTTTAAGCGTCCCGTGAATGCTCGAGCATTCACGGGACGCTTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142965.1-485s21c1
Sequence:CCGGTCCTTAGCTACCGGATGATAGCTCGAGCTATCATCCGGTAGCTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142965.1-833s21c1
Sequence:CCGGCCATCACTCGTCACGACATAGCTCGAGCTATGTCGTGACGAGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142965.1-3124s21c1
Sequence:CCGGATAGTCTACCCGACGAGTAATCTCGAGATTACTCGTCGGGTAGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001142965
FRRS1L MISSION shRNA Lentiviral Transduction Particles
ferric-chelate reductase 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142965.1-631s21c1
Sequence:CCGGCGCATACAGCACTTCTATAATCTCGAGATTATAGAAGTGCTGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142965.1-734s21c1
Sequence:CCGGGGTTTAAGCGTCCCGTGAATGCTCGAGCATTCACGGGACGCTTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142965.1-485s21c1
Sequence:CCGGTCCTTAGCTACCGGATGATAGCTCGAGCTATCATCCGGTAGCTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142965.1-833s21c1
Sequence:CCGGCCATCACTCGTCACGACATAGCTCGAGCTATGTCGTGACGAGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142965.1-3124s21c1
Sequence:CCGGATAGTCTACCCGACGAGTAATCTCGAGATTACTCGTCGGGTAGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks