EMAIL THIS PAGE TO A FRIEND

FRS2

fibroblast growth factor receptor substrate 2

345 Gene Product Result for
Synonyms: FRS2A FRS2alpha SNT SNT-1 SNT1
UniProtKB ID: Q8WU20, B0LPF2, B2R684, O43558, Q7LDQ6
Gene ID:
Mouse(327826) fibroblast growth factor receptor substrate 2
Rat(314850) fibroblast growth factor receptor substrate 2
Thale Cress(817785) FAR1-related protein
dog(474444) fibroblast growth factor receptor substrate 2
Horse(100052205) fibroblast growth factor receptor substrate 2
cow(538624) fibroblast growth factor receptor substrate 2
domestic cat(101099133) fibroblast growth factor receptor substrate 2
chicken(417845) fibroblast growth factor receptor substrate 2
sheep(101102468) fibroblast growth factor receptor substrate 2
sheep(100191036) fibroblast growth factor receptor substrate 2
domestic guinea pig(100727252) fibroblast growth factor receptor substrate 2
naked mole-rat(101696593) fibroblast growth factor receptor substrate 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006654 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006654 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006654 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177798 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177798 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177798 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042555 Rosetta Predictions human pricing
NM_006654 Rosetta Predictions human pricing
NM_001108097 Rosetta Predictions rat pricing
NM_177798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310568 predicted 996
2 SASI_Hs02_00310569 predicted 1585
3 SASI_Hs02_00310570 predicted 961
4 SASI_Hs02_00310571 predicted 590
5 SASI_Hs02_00310572 predicted 1951
6 SASI_Hs02_00310573 predicted 1735
7 SASI_Hs02_00310574 predicted 762
8 SASI_Hs02_00310575 predicted 1063
9 SASI_Hs02_00310576 predicted 1629
10 SASI_Hs02_00310577 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342033 predicted 997
2 SASI_Hs01_00078039 predicted 1595
3 SASI_Hs01_00078040 predicted 968
4 SASI_Hs01_00078041 predicted 598
5 SASI_Hs02_00342034 predicted 1962
6 SASI_Hs01_00078042 predicted 1745
7 SASI_Hs01_00078044 predicted 764
8 SASI_Hs01_00078045 predicted 1071
9 SASI_Hs01_00078046 predicted 1643
10 SASI_Hs02_00342035 predicted 1351
11 SASI_Hs01_00078038 predicted 298
12 SASI_Hs01_00078043 predicted 285
13 SASI_Hs01_00078047 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235324 predicted 312
2 SASI_Rn02_00235325 predicted 457
3 SASI_Rn02_00235326 predicted 829
4 SASI_Rn02_00235327 predicted 1421
5 SASI_Rn02_00235328 predicted 299
6 SASI_Rn02_00235329 predicted 1026
7 SASI_Rn02_00235330 predicted 1390
8 SASI_Rn02_00235331 predicted 1188
9 SASI_Rn02_00235332 predicted 837
10 SASI_Rn02_00235333 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047945 predicted 1380
2 SASI_Mm01_00047946 predicted 542
3 SASI_Mm01_00047947 predicted 920
4 SASI_Mm02_00348236 predicted 1609
5 SASI_Mm01_00047948 predicted 1515
6 SASI_Mm01_00047949 predicted 1593
7 SASI_Mm01_00047950 predicted 386
8 SASI_Mm01_00047952 predicted 1788
9 SASI_Mm01_00047953 predicted 867
10 SASI_Mm01_00047954 predicted 779
11 SASI_Mm01_00047951 predicted 1492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006654
VALIDATED
FRS2 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor receptor substrate 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006654.3-2405s21c1
Sequence:CCGGCATTGCTAACAGGTAACTATACTCGAGTATAGTTACCTGTTAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006654.3-1643s21c1
Sequence:CCGGCTCTAAATGGCTACCATAATACTCGAGTATTATGGTAGCCATTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006654.3-562s21c1
Sequence:CCGGCGGAACAAGTTTAAGGTCATTCTCGAGAATGACCTTAAACTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006654.3-1594s21c1
Sequence:CCGGCGCAAGCTAAGTAGGGATGAACTCGAGTTCATCCCTACTTAGCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006654.3-700s21c1
Sequence:CCGGCGCTATGGCTATGACTCGAATCTCGAGATTCGAGTCATAGCCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006654.2-298s1c1
Sequence:CCGGCGGAACAAGTTTAAGGTCATTCTCGAGAATGACCTTAAACTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006654.2-1330s1c1
Sequence:CCGGCGCAAGCTAAGTAGGGATGAACTCGAGTTCATCCCTACTTAGCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006654.2-1661s1c1
Sequence:CCGGCCGTGATAGACATCGAGAGAACTCGAGTTCTCTCGATGTCTATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006654.2-521s1c1
Sequence:CCGGCCCGTGCAGAAGAATTATTTACTCGAGTAAATAATTCTTCTGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006654.2-436s1c1
Sequence:CCGGCGCTATGGCTATGACTCGAATCTCGAGATTCGAGTCATAGCCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006654
VALIDATED
FRS2 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor receptor substrate 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006654.3-2405s21c1
Sequence:CCGGCATTGCTAACAGGTAACTATACTCGAGTATAGTTACCTGTTAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006654.3-1643s21c1
Sequence:CCGGCTCTAAATGGCTACCATAATACTCGAGTATTATGGTAGCCATTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006654.3-562s21c1
Sequence:CCGGCGGAACAAGTTTAAGGTCATTCTCGAGAATGACCTTAAACTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006654.3-1594s21c1
Sequence:CCGGCGCAAGCTAAGTAGGGATGAACTCGAGTTCATCCCTACTTAGCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006654.3-700s21c1
Sequence:CCGGCGCTATGGCTATGACTCGAATCTCGAGATTCGAGTCATAGCCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006654.2-298s1c1
Sequence:CCGGCGGAACAAGTTTAAGGTCATTCTCGAGAATGACCTTAAACTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006654.2-1330s1c1
Sequence:CCGGCGCAAGCTAAGTAGGGATGAACTCGAGTTCATCCCTACTTAGCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006654.2-1661s1c1
Sequence:CCGGCCGTGATAGACATCGAGAGAACTCGAGTTCTCTCGATGTCTATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006654.2-521s1c1
Sequence:CCGGCCCGTGCAGAAGAATTATTTACTCGAGTAAATAATTCTTCTGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006654.2-436s1c1
Sequence:CCGGCGCTATGGCTATGACTCGAATCTCGAGATTCGAGTCATAGCCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006654
VALIDATED
FRS2 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor receptor substrate 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006654.3-2405s21c1
Sequence:CCGGCATTGCTAACAGGTAACTATACTCGAGTATAGTTACCTGTTAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006654.3-1643s21c1
Sequence:CCGGCTCTAAATGGCTACCATAATACTCGAGTATTATGGTAGCCATTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006654.3-562s21c1
Sequence:CCGGCGGAACAAGTTTAAGGTCATTCTCGAGAATGACCTTAAACTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006654.3-1594s21c1
Sequence:CCGGCGCAAGCTAAGTAGGGATGAACTCGAGTTCATCCCTACTTAGCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006654.3-700s21c1
Sequence:CCGGCGCTATGGCTATGACTCGAATCTCGAGATTCGAGTCATAGCCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006654.2-298s1c1
Sequence:CCGGCGGAACAAGTTTAAGGTCATTCTCGAGAATGACCTTAAACTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006654.2-1330s1c1
Sequence:CCGGCGCAAGCTAAGTAGGGATGAACTCGAGTTCATCCCTACTTAGCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006654.2-1661s1c1
Sequence:CCGGCCGTGATAGACATCGAGAGAACTCGAGTTCTCTCGATGTCTATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006654.2-521s1c1
Sequence:CCGGCCCGTGCAGAAGAATTATTTACTCGAGTAAATAATTCTTCTGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006654.2-436s1c1
Sequence:CCGGCGCTATGGCTATGACTCGAATCTCGAGATTCGAGTCATAGCCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177798
VALIDATED
FRS2 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor receptor substrate 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177798.3-3299s1c1
Sequence:CCGGCCTGGTTATGATCTGGATATACTCGAGTATATCCAGATCATAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177798.3-1605s1c1
Sequence:CCGGCGACAGTCTTTAACTTTGATACTCGAGTATCAAAGTTAAAGACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177798.3-1485s1c1
Sequence:CCGGCATCTCTAAATGGCTACCATACTCGAGTATGGTAGCCATTTAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177798.3-1604s1c1
Sequence:CCGGCCGACAGTCTTTAACTTTGATCTCGAGATCAAAGTTAAAGACTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177798.3-1253s1c1
Sequence:CCGGCCTGTCAACAAACTGGTGTATCTCGAGATACACCAGTTTGTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177798
VALIDATED
FRS2 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor receptor substrate 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177798.3-3299s1c1
Sequence:CCGGCCTGGTTATGATCTGGATATACTCGAGTATATCCAGATCATAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177798.3-1605s1c1
Sequence:CCGGCGACAGTCTTTAACTTTGATACTCGAGTATCAAAGTTAAAGACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177798.3-1485s1c1
Sequence:CCGGCATCTCTAAATGGCTACCATACTCGAGTATGGTAGCCATTTAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177798.3-1604s1c1
Sequence:CCGGCCGACAGTCTTTAACTTTGATCTCGAGATCAAAGTTAAAGACTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177798.3-1253s1c1
Sequence:CCGGCCTGTCAACAAACTGGTGTATCTCGAGATACACCAGTTTGTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177798
VALIDATED
FRS2 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor receptor substrate 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177798.3-3299s1c1
Sequence:CCGGCCTGGTTATGATCTGGATATACTCGAGTATATCCAGATCATAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177798.3-1605s1c1
Sequence:CCGGCGACAGTCTTTAACTTTGATACTCGAGTATCAAAGTTAAAGACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177798.3-1485s1c1
Sequence:CCGGCATCTCTAAATGGCTACCATACTCGAGTATGGTAGCCATTTAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177798.3-1604s1c1
Sequence:CCGGCCGACAGTCTTTAACTTTGATCTCGAGATCAAAGTTAAAGACTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177798.3-1253s1c1
Sequence:CCGGCCTGTCAACAAACTGGTGTATCTCGAGATACACCAGTTTGTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks