EMAIL THIS PAGE TO A FRIEND

FRS3

fibroblast growth factor receptor substrate 3

75 Gene Product Result for
Synonyms: FRS2-beta FRS2B FRS2beta SNT-2 SNT2
UniProtKB ID: O43559, Q5T3D5
Gene ID:
Human(10817) Summary: This gene encodes a substrate for the fibroblast growth factor receptor. The encoded protein is found in the peripheral plasma membrane and links fibroblast growth factor receptor stimulation to activators of Ras. The encoded protein down-regulates extracellular regulated kinase 2 through direct binding. [provided by RefSeq, Jul 2013]
Mouse(107971) fibroblast growth factor receptor substrate 3
Rat(316213) fibroblast growth factor receptor substrate 3
Thale Cress(817253) FAR1-related sequence 3
chicken(419923) fibroblast growth factor receptor substrate 3
domestic cat(101100304) fibroblast growth factor receptor substrate 3
dog(481794) fibroblast growth factor receptor substrate 3
Horse(100054379) fibroblast growth factor receptor substrate 3
cow(509838) fibroblast growth factor receptor substrate 3
naked mole-rat(101712140) fibroblast growth factor receptor substrate 3
domestic guinea pig(100716560) fibroblast growth factor receptor substrate 3
sheep(101106889) fibroblast growth factor receptor substrate 3
Domestic Rabbit(100328715) fibroblast growth factor receptor substrate 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006653 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006653 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006653 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144939 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144939 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144939 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006653 Rosetta Predictions human pricing
NM_001017382 Rosetta Predictions rat pricing
NM_144939 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011336 predicted 584
2 SASI_Hs02_00342032 predicted 1805
3 SASI_Hs01_00011337 predicted 1083
4 SASI_Hs01_00011338 predicted 582
5 SASI_Hs01_00011339 predicted 292
6 SASI_Hs01_00011340 predicted 554
7 SASI_Hs01_00011341 predicted 1041
8 SASI_Hs01_00011342 predicted 442
9 SASI_Hs01_00011344 predicted 1151
10 SASI_Hs01_00011345 predicted 991
11 SASI_Hs01_00011343 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017382 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202228 predicted 477
2 SASI_Rn01_00089077 predicted 1409
3 SASI_Rn01_00089078 predicted 370
4 SASI_Rn01_00089080 predicted 252
5 SASI_Rn01_00089081 predicted 922
6 SASI_Rn01_00089082 predicted 1375
7 SASI_Rn01_00089083 predicted 256
8 SASI_Rn01_00089084 predicted 252
9 SASI_Rn01_00089085 predicted 1261
10 SASI_Rn01_00089086 predicted 1127
11 SASI_Rn01_00089079 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144939 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066478 predicted 263
2 SASI_Mm01_00066479 predicted 275
3 SASI_Mm01_00066480 predicted 256
4 SASI_Mm01_00066481 predicted 646
5 SASI_Mm01_00066482 predicted 416
6 SASI_Mm01_00066483 predicted 386
7 SASI_Mm01_00066484 predicted 1076
8 SASI_Mm01_00066485 predicted 420
9 SASI_Mm01_00066486 predicted 355
10 SASI_Mm01_00066487 predicted 414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006653
FRS3 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor receptor substrate 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006653.3-1043s1c1
Sequence:CCGGCCACACCACAATAATAACAATCTCGAGATTGTTATTATTGTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006653.3-299s1c1
Sequence:CCGGACCAAGTTCAAGGTGACAAATCTCGAGATTTGTCACCTTGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006653.3-1486s1c1
Sequence:CCGGGCTTAACTACATCCAGGTGGACTCGAGTCCACCTGGATGTAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006653.3-1433s1c1
Sequence:CCGGCCAAGGGTCTTCAACTTTGATCTCGAGATCAAAGTTGAAGACCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006653.3-590s1c1
Sequence:CCGGCCTGTCATCATCACCCGCAATCTCGAGATTGCGGGTGATGATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006653.3-1970s21c1
Sequence:CCGGGGGTTCCTGTGATTGCGTTTACTCGAGTAAACGCAATCACAGGAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006653.3-1880s21c1
Sequence:CCGGAGATATCAGCCACCGAGTCTCCTCGAGGAGACTCGGTGGCTGATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006653.3-558s21c1
Sequence:CCGGTGCAGTGCAACAGCATCAATGCTCGAGCATTGATGCTGTTGCACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006653
FRS3 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor receptor substrate 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006653.3-1043s1c1
Sequence:CCGGCCACACCACAATAATAACAATCTCGAGATTGTTATTATTGTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006653.3-299s1c1
Sequence:CCGGACCAAGTTCAAGGTGACAAATCTCGAGATTTGTCACCTTGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006653.3-1486s1c1
Sequence:CCGGGCTTAACTACATCCAGGTGGACTCGAGTCCACCTGGATGTAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006653.3-1433s1c1
Sequence:CCGGCCAAGGGTCTTCAACTTTGATCTCGAGATCAAAGTTGAAGACCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006653.3-590s1c1
Sequence:CCGGCCTGTCATCATCACCCGCAATCTCGAGATTGCGGGTGATGATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006653.3-1970s21c1
Sequence:CCGGGGGTTCCTGTGATTGCGTTTACTCGAGTAAACGCAATCACAGGAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006653.3-1880s21c1
Sequence:CCGGAGATATCAGCCACCGAGTCTCCTCGAGGAGACTCGGTGGCTGATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006653.3-558s21c1
Sequence:CCGGTGCAGTGCAACAGCATCAATGCTCGAGCATTGATGCTGTTGCACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006653
FRS3 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor receptor substrate 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006653.3-1043s1c1
Sequence:CCGGCCACACCACAATAATAACAATCTCGAGATTGTTATTATTGTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006653.3-299s1c1
Sequence:CCGGACCAAGTTCAAGGTGACAAATCTCGAGATTTGTCACCTTGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006653.3-1486s1c1
Sequence:CCGGGCTTAACTACATCCAGGTGGACTCGAGTCCACCTGGATGTAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006653.3-1433s1c1
Sequence:CCGGCCAAGGGTCTTCAACTTTGATCTCGAGATCAAAGTTGAAGACCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006653.3-590s1c1
Sequence:CCGGCCTGTCATCATCACCCGCAATCTCGAGATTGCGGGTGATGATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006653.3-1970s21c1
Sequence:CCGGGGGTTCCTGTGATTGCGTTTACTCGAGTAAACGCAATCACAGGAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006653.3-1880s21c1
Sequence:CCGGAGATATCAGCCACCGAGTCTCCTCGAGGAGACTCGGTGGCTGATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006653.3-558s21c1
Sequence:CCGGTGCAGTGCAACAGCATCAATGCTCGAGCATTGATGCTGTTGCACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144939
FRS3 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor receptor substrate 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144939.1-1968s1c1
Sequence:CCGGGCTGTCCATGTGTTTGTGCTTCTCGAGAAGCACAAACACATGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144939.1-1598s1c1
Sequence:CCGGGCCGTGATTGACCTCAAGAAACTCGAGTTTCTTGAGGTCAATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144939.1-1422s1c1
Sequence:CCGGCGCGGGTCTTCAACTTTGATTCTCGAGAATCAAAGTTGAAGACCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144939.1-277s1c1
Sequence:CCGGCAACCACCCTACCAAGTTCAACTCGAGTTGAACTTGGTAGGGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144939.1-799s1c1
Sequence:CCGGGCAGTCTCACACCTATGTCAACTCGAGTTGACATAGGTGTGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144939.2-768s21c1
Sequence:CCGGAGTCTACCCACACCCTCATTGCTCGAGCAATGAGGGTGTGGGTAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144939.2-1911s21c1
Sequence:CCGGAGGGTTCTCAAGGTTGCATTTCTCGAGAAATGCAACCTTGAGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144939
FRS3 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor receptor substrate 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144939.1-1968s1c1
Sequence:CCGGGCTGTCCATGTGTTTGTGCTTCTCGAGAAGCACAAACACATGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144939.1-1598s1c1
Sequence:CCGGGCCGTGATTGACCTCAAGAAACTCGAGTTTCTTGAGGTCAATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144939.1-1422s1c1
Sequence:CCGGCGCGGGTCTTCAACTTTGATTCTCGAGAATCAAAGTTGAAGACCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144939.1-277s1c1
Sequence:CCGGCAACCACCCTACCAAGTTCAACTCGAGTTGAACTTGGTAGGGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144939.1-799s1c1
Sequence:CCGGGCAGTCTCACACCTATGTCAACTCGAGTTGACATAGGTGTGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144939.2-768s21c1
Sequence:CCGGAGTCTACCCACACCCTCATTGCTCGAGCAATGAGGGTGTGGGTAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144939.2-1911s21c1
Sequence:CCGGAGGGTTCTCAAGGTTGCATTTCTCGAGAAATGCAACCTTGAGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144939
FRS3 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor receptor substrate 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144939.1-1968s1c1
Sequence:CCGGGCTGTCCATGTGTTTGTGCTTCTCGAGAAGCACAAACACATGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144939.1-1598s1c1
Sequence:CCGGGCCGTGATTGACCTCAAGAAACTCGAGTTTCTTGAGGTCAATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144939.1-1422s1c1
Sequence:CCGGCGCGGGTCTTCAACTTTGATTCTCGAGAATCAAAGTTGAAGACCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144939.1-277s1c1
Sequence:CCGGCAACCACCCTACCAAGTTCAACTCGAGTTGAACTTGGTAGGGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144939.1-799s1c1
Sequence:CCGGGCAGTCTCACACCTATGTCAACTCGAGTTGACATAGGTGTGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144939.2-768s21c1
Sequence:CCGGAGTCTACCCACACCCTCATTGCTCGAGCAATGAGGGTGTGGGTAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144939.2-1911s21c1
Sequence:CCGGAGGGTTCTCAAGGTTGCATTTCTCGAGAAATGCAACCTTGAGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks