EMAIL THIS PAGE TO A FRIEND

FRY

furry homolog (Drosophila)

Synonyms: 13CDNA73 214K23.2 C13orf14 CG003 bA207N4.2 bA37E23.1
UniProtKB ID: Q5TBA9, Q9Y3N6
Gene ID:
Mouse(320365) furry homolog (Drosophila)
Rat(304244) furry homolog (Drosophila)
Horse(100062217) furry homolog (Drosophila)
cow(507622) furry homolog (Drosophila)
domestic cat(101101436) furry homolog (Drosophila)
chicken(418915) furry homolog (Drosophila)
dog(477318) furry homolog (Drosophila)
sheep(101110521) furry homolog (Drosophila)
Domestic Rabbit(100355827) furry homolog (Drosophila)
domestic guinea pig(100723488) furry homolog (Drosophila)
naked mole-rat(101699486) furry homolog (Drosophila)
171 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_023037 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023037 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023037 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023037 Rosetta Predictions human pricing
XM_221867 Rosetta Predictions rat pricing
XR_008372 Rosetta Predictions rat pricing
XM_001477828 Rosetta Predictions mouse pricing
XM_488539 Rosetta Predictions mouse pricing
XM_976343 Rosetta Predictions mouse pricing
XM_990745 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356298 predicted 2214
2 SASI_Hs01_00129327 predicted 5961
3 SASI_Hs01_00129328 predicted 4235
4 SASI_Hs01_00129329 predicted 2839
5 SASI_Hs01_00129330 predicted 6701
6 SASI_Hs01_00129331 predicted 1643
7 SASI_Hs01_00129333 predicted 1384
8 SASI_Hs01_00129334 predicted 8422
9 SASI_Hs02_00356299 predicted 1769
10 SASI_Hs02_00356300 predicted 6720
11 SASI_Hs01_00129326 predicted 6969
12 SASI_Hs01_00129332 predicted 5873
13 SASI_Hs01_00129335 predicted 6216
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147488 predicted 5477
2 SASI_Rn01_00147489 predicted 3637
3 SASI_Rn01_00147490 predicted 8494
4 SASI_Rn01_00147491 predicted 7658
5 SASI_Rn01_00147492 predicted 1349
6 SASI_Rn01_00147493 predicted 427
7 SASI_Rn01_00147494 predicted 5486
8 SASI_Rn01_00147495 predicted 10744
9 SASI_Rn01_00147496 predicted 10833
10 SASI_Rn01_00147497 predicted 2099
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008372 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160763 predicted 4031
2 SASI_Rn01_00160764 predicted 2493
3 SASI_Rn01_00160765 predicted 6438
4 SASI_Rn01_00160766 predicted 10248
5 SASI_Rn01_00160767 predicted 4052
6 SASI_Rn01_00160768 predicted 8640
7 SASI_Rn01_00160770 predicted 10297
8 SASI_Rn01_00160771 predicted 10361
9 SASI_Rn01_00160772 predicted 10011
10 SASI_Rn02_00416865 predicted 3323
11 SASI_Rn01_00160769 predicted 8728
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00398359 predicted 9223
2 SASI_Mm02_00398360 predicted 3146
3 SASI_Mm02_00398361 predicted 3798
4 SASI_Mm02_00398362 predicted 7903
5 SASI_Mm02_00398363 predicted 9755
6 SASI_Mm02_00398364 predicted 11641
7 SASI_Mm02_00398365 predicted 9158
8 SASI_Mm02_00398366 predicted 3162
9 SASI_Mm02_00398367 predicted 4719
10 SASI_Mm02_00398368 predicted 6467
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_488539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427096 predicted 3964
2 SASI_Mm02_00427097 predicted 6720
3 SASI_Mm02_00427098 predicted 650
4 SASI_Mm02_00427099 predicted 1297
5 SASI_Mm02_00427100 predicted 5400
6 SASI_Mm02_00427101 predicted 5020
7 SASI_Mm02_00427102 predicted 7254
8 SASI_Mm02_00427103 predicted 9144
9 SASI_Mm02_00427104 predicted 6662
10 SASI_Mm02_00427105 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00445969 predicted 9219
2 SASI_Mm02_00445970 predicted 3151
3 SASI_Mm02_00445971 predicted 3795
4 SASI_Mm02_00445972 predicted 7896
5 SASI_Mm02_00445973 predicted 9759
6 SASI_Mm02_00445974 predicted 11645
7 SASI_Mm02_00445975 predicted 9155
8 SASI_Mm02_00445976 predicted 3159
9 SASI_Mm02_00445977 predicted 4719
10 SASI_Mm02_00445978 predicted 6470
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_990745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252168 predicted 6839
2 SASI_Mm01_00252169 predicted 765
3 SASI_Mm01_00252170 predicted 5510
4 SASI_Mm01_00252171 predicted 5129
5 SASI_Mm01_00252172 predicted 7378
6 SASI_Mm01_00252173 predicted 6768
7 SASI_Mm01_00252174 predicted 778
8 SASI_Mm01_00252175 predicted 2336
9 SASI_Mm01_00252176 predicted 1488
10 SASI_Mm01_00252177 predicted 4091
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172887
FRY MISSION shRNA Bacterial Glycerol Stock
furry homolog (Drosophila)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172887.2-3888s21c1
Sequence:CCGGGTATAAGTGGCTCGACAATATCTCGAGATATTGTCGAGCCACTTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172887.2-9676s21c1
Sequence:CCGGGACATGACTTCCGTTGCATTACTCGAGTAATGCAACGGAAGTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172887.2-4744s21c1
Sequence:CCGGACCATCCTCCTGCCCTATATTCTCGAGAATATAGGGCAGGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172887.2-9635s21c1
Sequence:CCGGGCTACCCTTCACCAAGCAAATCTCGAGATTTGCTTGGTGAAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172887.2-3430s21c1
Sequence:CCGGCTTCAGCTGCTTCGGATATTCCTCGAGGAATATCCGAAGCAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172887.2-8091s21c1
Sequence:CCGGGGCTTCTTTGCCTGATATAAACTCGAGTTTATATCAGGCAAAGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172887.2-806s21c1
Sequence:CCGGATGAACAGCAGCGAGACTATTCTCGAGAATAGTCTCGCTGCTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172887
FRY MISSION shRNA shRNA Plasmid DNA
furry homolog (Drosophila)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172887.2-3888s21c1
Sequence:CCGGGTATAAGTGGCTCGACAATATCTCGAGATATTGTCGAGCCACTTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172887.2-9676s21c1
Sequence:CCGGGACATGACTTCCGTTGCATTACTCGAGTAATGCAACGGAAGTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172887.2-4744s21c1
Sequence:CCGGACCATCCTCCTGCCCTATATTCTCGAGAATATAGGGCAGGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172887.2-9635s21c1
Sequence:CCGGGCTACCCTTCACCAAGCAAATCTCGAGATTTGCTTGGTGAAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172887.2-3430s21c1
Sequence:CCGGCTTCAGCTGCTTCGGATATTCCTCGAGGAATATCCGAAGCAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172887.2-8091s21c1
Sequence:CCGGGGCTTCTTTGCCTGATATAAACTCGAGTTTATATCAGGCAAAGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172887.2-806s21c1
Sequence:CCGGATGAACAGCAGCGAGACTATTCTCGAGAATAGTCTCGCTGCTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172887
FRY MISSION shRNA Lentiviral Transduction Particles
furry homolog (Drosophila)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172887.2-3888s21c1
Sequence:CCGGGTATAAGTGGCTCGACAATATCTCGAGATATTGTCGAGCCACTTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172887.2-9676s21c1
Sequence:CCGGGACATGACTTCCGTTGCATTACTCGAGTAATGCAACGGAAGTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172887.2-4744s21c1
Sequence:CCGGACCATCCTCCTGCCCTATATTCTCGAGAATATAGGGCAGGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172887.2-9635s21c1
Sequence:CCGGGCTACCCTTCACCAAGCAAATCTCGAGATTTGCTTGGTGAAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172887.2-3430s21c1
Sequence:CCGGCTTCAGCTGCTTCGGATATTCCTCGAGGAATATCCGAAGCAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172887.2-8091s21c1
Sequence:CCGGGGCTTCTTTGCCTGATATAAACTCGAGTTTATATCAGGCAAAGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172887.2-806s21c1
Sequence:CCGGATGAACAGCAGCGAGACTATTCTCGAGAATAGTCTCGCTGCTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023037
FRY MISSION shRNA Bacterial Glycerol Stock
furry homolog (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023037.1-961s1c1
Sequence:CCGGCGATGAACAACAGCGAGATTACTCGAGTAATCTCGCTGTTGTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023037.1-1539s1c1
Sequence:CCGGCGCTGGAACTTTCTTCTCGAACTCGAGTTCGAGAAGAAAGTTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023037.1-2012s1c1
Sequence:CCGGGCTGATAGCTTGCAGCAGAAACTCGAGTTTCTGCTGCAAGCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023037.1-8304s1c1
Sequence:CCGGCCGTGCATGAGGATGATCTTTCTCGAGAAAGATCATCCTCATGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023037.1-6968s1c1
Sequence:CCGGCCCAATCAGTTCTGTAAGGATCTCGAGATCCTTACAGAACTGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023037.1-960s1c1
Sequence:CCGGGCGATGAACAACAGCGAGATTCTCGAGAATCTCGCTGTTGTTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023037.1-3216s1c1
Sequence:CCGGGCGGAGACAACTATGTTACTTCTCGAGAAGTAACATAGTTGTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145440    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023037.1-9773s1c1
Sequence:CCGGGTTACATTTGACCGAGCATATCTCGAGATATGCTCGGTCAAATGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144616    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023037.1-10301s1c1
Sequence:CCGGGCTGAAGGATGAGTGTTAATTCTCGAGAATTAACACTCATCCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023037
FRY MISSION shRNA shRNA Plasmid DNA
furry homolog (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023037.1-961s1c1
Sequence:CCGGCGATGAACAACAGCGAGATTACTCGAGTAATCTCGCTGTTGTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023037.1-1539s1c1
Sequence:CCGGCGCTGGAACTTTCTTCTCGAACTCGAGTTCGAGAAGAAAGTTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023037.1-2012s1c1
Sequence:CCGGGCTGATAGCTTGCAGCAGAAACTCGAGTTTCTGCTGCAAGCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023037.1-8304s1c1
Sequence:CCGGCCGTGCATGAGGATGATCTTTCTCGAGAAAGATCATCCTCATGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023037.1-6968s1c1
Sequence:CCGGCCCAATCAGTTCTGTAAGGATCTCGAGATCCTTACAGAACTGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023037.1-960s1c1
Sequence:CCGGGCGATGAACAACAGCGAGATTCTCGAGAATCTCGCTGTTGTTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023037.1-3216s1c1
Sequence:CCGGGCGGAGACAACTATGTTACTTCTCGAGAAGTAACATAGTTGTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145440    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023037.1-9773s1c1
Sequence:CCGGGTTACATTTGACCGAGCATATCTCGAGATATGCTCGGTCAAATGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144616    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023037.1-10301s1c1
Sequence:CCGGGCTGAAGGATGAGTGTTAATTCTCGAGAATTAACACTCATCCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023037
FRY MISSION shRNA Lentiviral Transduction Particles
furry homolog (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023037.1-961s1c1
Sequence:CCGGCGATGAACAACAGCGAGATTACTCGAGTAATCTCGCTGTTGTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023037.1-1539s1c1
Sequence:CCGGCGCTGGAACTTTCTTCTCGAACTCGAGTTCGAGAAGAAAGTTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023037.1-2012s1c1
Sequence:CCGGGCTGATAGCTTGCAGCAGAAACTCGAGTTTCTGCTGCAAGCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023037.1-8304s1c1
Sequence:CCGGCCGTGCATGAGGATGATCTTTCTCGAGAAAGATCATCCTCATGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023037.1-6968s1c1
Sequence:CCGGCCCAATCAGTTCTGTAAGGATCTCGAGATCCTTACAGAACTGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023037.1-960s1c1
Sequence:CCGGGCGATGAACAACAGCGAGATTCTCGAGAATCTCGCTGTTGTTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023037.1-3216s1c1
Sequence:CCGGGCGGAGACAACTATGTTACTTCTCGAGAAGTAACATAGTTGTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145440    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023037.1-9773s1c1
Sequence:CCGGGTTACATTTGACCGAGCATATCTCGAGATATGCTCGGTCAAATGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144616    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023037.1-10301s1c1
Sequence:CCGGGCTGAAGGATGAGTGTTAATTCTCGAGAATTAACACTCATCCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks