EMAIL THIS PAGE TO A FRIEND

FRYL

FRY-like

178 Gene Product Result for
Synonyms: KIAA0826
UniProtKB ID: O94915, O95640, Q8WTZ5, Q9NT40
Gene ID:
Mouse(72313) furry homolog-like (Drosophila)
Rat(364144) FRY-like
Zebrafish(558173) furry homolog-like (Drosophila)
chicken(422765) FRY-like
cow(511059) FRY-like
Horse(100054294) FRY-like
dog(475139) FRY-like
sheep(101102983) FRY-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177136 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177136 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177136 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_028194 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028194 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028194 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015030 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015030 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015030 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039751 Rosetta Predictions human pricing
NM_015030 Rosetta Predictions human pricing
XM_344235 Rosetta Predictions rat pricing
XR_009111 Rosetta Predictions rat pricing
NM_028194 Rosetta Predictions mouse pricing
NM_177136 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198329 predicted 631
2 SASI_Hs01_00198330 predicted 742
3 SASI_Hs01_00198331 predicted 940
4 SASI_Hs01_00198332 predicted 739
5 SASI_Hs01_00198333 predicted 575
6 SASI_Hs01_00198334 predicted 895
7 SASI_Hs01_00198335 predicted 927
8 SASI_Hs01_00198336 predicted 850
9 SASI_Hs01_00198337 predicted 856
10 SASI_Hs01_00198338 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346833 predicted 7180
2 SASI_Hs02_00346834 predicted 6358
3 SASI_Hs02_00346835 predicted 4625
4 SASI_Hs02_00346836 predicted 6292
5 SASI_Hs02_00346837 predicted 9000
6 SASI_Hs02_00346838 predicted 3910
7 SASI_Hs02_00346839 predicted 9234
8 SASI_Hs02_00346840 predicted 2874
9 SASI_Hs02_00346841 predicted 8202
10 SASI_Hs02_00346842 predicted 8044
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126500 predicted 8359
2 SASI_Rn01_00126501 predicted 4791
3 SASI_Rn01_00126502 predicted 1515
4 SASI_Rn01_00126503 predicted 4788
5 SASI_Rn01_00126504 predicted 3005
6 SASI_Rn01_00126505 predicted 5522
7 SASI_Rn01_00126506 predicted 4075
8 SASI_Rn01_00126507 predicted 4134
9 SASI_Rn01_00126508 predicted 2845
10 SASI_Rn01_00126509 predicted 2048
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00128522 predicted 5294
2 SASI_Rn01_00128523 predicted 1913
3 SASI_Rn01_00128524 predicted 5289
4 SASI_Rn01_00128525 predicted 3497
5 SASI_Rn01_00128526 predicted 3593
6 SASI_Rn01_00128527 predicted 6027
7 SASI_Rn01_00128528 predicted 3465
8 SASI_Rn01_00128529 predicted 4684
9 SASI_Rn01_00128531 predicted 4619
10 SASI_Rn02_00418808 predicted 6769
11 SASI_Rn01_00128530 predicted 6299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333495 predicted 2505
2 SASI_Mm02_00333496 predicted 2321
3 SASI_Mm02_00333497 predicted 1333
4 SASI_Mm02_00333498 predicted 1181
5 SASI_Mm02_00333499 predicted 2094
6 SASI_Mm02_00333500 predicted 2436
7 SASI_Mm02_00333501 predicted 2103
8 SASI_Mm02_00333502 predicted 1855
9 SASI_Mm02_00333503 predicted 1113
10 SASI_Mm02_00333504 predicted 1852
11 SASI_Mm01_00196575 predicted 2017
12 SASI_Mm01_00196576 predicted 3883
13 SASI_Mm01_00196577 predicted 1080
14 SASI_Mm01_00196578 predicted 2269
15 SASI_Mm01_00196579 predicted 1018
16 SASI_Mm01_00196580 predicted 3680
17 SASI_Mm01_00196581 predicted 956
18 SASI_Mm01_00196582 predicted 1875
19 SASI_Mm01_00196583 predicted 335
20 SASI_Mm01_00196584 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184129 predicted 2222
2 SASI_Mm01_00184130 predicted 2043
3 SASI_Mm02_00347125 predicted 1044
4 SASI_Mm01_00184132 predicted 900
5 SASI_Mm01_00184138 predicted 1811
6 SASI_Mm02_00347126 predicted 2147
7 SASI_Mm02_00347127 predicted 1826
8 SASI_Mm02_00347128 predicted 1574
9 SASI_Mm02_00347129 predicted 831
10 SASI_Mm02_00347130 predicted 1569
11 SASI_Mm01_00184131 predicted 414
12 SASI_Mm01_00184133 predicted 2618
13 SASI_Mm01_00184134 predicted 2172
14 SASI_Mm01_00184135 predicted 2612
15 SASI_Mm01_00184136 predicted 2601
16 SASI_Mm01_00184137 predicted 2649
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177136
VALIDATED
FRYL MISSION shRNA Bacterial Glycerol Stock
FRY-like
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177136.2-2795s1c1
Sequence:CCGGCCCTAAGACATTTCCCTTAAACTCGAGTTTAAGGGAAATGTCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193383    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177136.2-2796s1c1
Sequence:CCGGCCTAAGACATTTCCCTTAAATCTCGAGATTTAAGGGAAATGTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177136.2-2651s1c1
Sequence:CCGGCGGAAATGTGTCTCCTTAACACTCGAGTGTTAAGGAGACACATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177136.2-2740s1c1
Sequence:CCGGGCTAGTTCTTATTGCCATTAACTCGAGTTAATGGCAATAAGAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177136.2-835s1c1
Sequence:CCGGGCATATCATTGCGGATTTATACTCGAGTATAAATCCGCAATGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177136.2-2856s1c1
Sequence:CCGGGCAAAGTCATGCAAAGAAATACTCGAGTATTTCTTTGCATGACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177136
VALIDATED
FRYL MISSION shRNA shRNA Plasmid DNA
FRY-like
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177136.2-2795s1c1
Sequence:CCGGCCCTAAGACATTTCCCTTAAACTCGAGTTTAAGGGAAATGTCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193383    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177136.2-2796s1c1
Sequence:CCGGCCTAAGACATTTCCCTTAAATCTCGAGATTTAAGGGAAATGTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177136.2-2651s1c1
Sequence:CCGGCGGAAATGTGTCTCCTTAACACTCGAGTGTTAAGGAGACACATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177136.2-2740s1c1
Sequence:CCGGGCTAGTTCTTATTGCCATTAACTCGAGTTAATGGCAATAAGAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177136.2-835s1c1
Sequence:CCGGGCATATCATTGCGGATTTATACTCGAGTATAAATCCGCAATGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177136.2-2856s1c1
Sequence:CCGGGCAAAGTCATGCAAAGAAATACTCGAGTATTTCTTTGCATGACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177136
VALIDATED
FRYL MISSION shRNA Lentiviral Transduction Particles
FRY-like
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177136.2-2795s1c1
Sequence:CCGGCCCTAAGACATTTCCCTTAAACTCGAGTTTAAGGGAAATGTCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193383    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177136.2-2796s1c1
Sequence:CCGGCCTAAGACATTTCCCTTAAATCTCGAGATTTAAGGGAAATGTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177136.2-2651s1c1
Sequence:CCGGCGGAAATGTGTCTCCTTAACACTCGAGTGTTAAGGAGACACATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177136.2-2740s1c1
Sequence:CCGGGCTAGTTCTTATTGCCATTAACTCGAGTTAATGGCAATAAGAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177136.2-835s1c1
Sequence:CCGGGCATATCATTGCGGATTTATACTCGAGTATAAATCCGCAATGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177136.2-2856s1c1
Sequence:CCGGGCAAAGTCATGCAAAGAAATACTCGAGTATTTCTTTGCATGACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028194
VALIDATED
FRYL MISSION shRNA Bacterial Glycerol Stock
FRY-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028194.1-583s1c1
Sequence:CCGGGCAGTCAAATGCAGAAGGAATCTCGAGATTCCTTCTGCATTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028194.2-3542s21c1
Sequence:CCGGGTACAGCTGGTACGGATATTTCTCGAGAAATATCCGTACCAGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028194.2-6484s1c1
Sequence:CCGGCATAACGGATGGACGGATAAACTCGAGTTTATCCGTCCATCCGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028194.2-6485s21c1
Sequence:CCGGATAACGGATGGACGGATAAACCTCGAGGTTTATCCGTCCATCCGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028194.2-5666s21c1
Sequence:CCGGACGTTCACAGCAGGCATTAACCTCGAGGTTAATGCCTGCTGTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028194.2-9692s21c1
Sequence:CCGGACCCTTGTGCTTCATTGATAACTCGAGTTATCAATGAAGCACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028194.2-8333s21c1
Sequence:CCGGGACGAAGGGTCATACGTTATTCTCGAGAATAACGTATGACCCTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028194
VALIDATED
FRYL MISSION shRNA shRNA Plasmid DNA
FRY-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028194.1-583s1c1
Sequence:CCGGGCAGTCAAATGCAGAAGGAATCTCGAGATTCCTTCTGCATTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028194.2-3542s21c1
Sequence:CCGGGTACAGCTGGTACGGATATTTCTCGAGAAATATCCGTACCAGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028194.2-6484s1c1
Sequence:CCGGCATAACGGATGGACGGATAAACTCGAGTTTATCCGTCCATCCGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028194.2-6485s21c1
Sequence:CCGGATAACGGATGGACGGATAAACCTCGAGGTTTATCCGTCCATCCGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028194.2-5666s21c1
Sequence:CCGGACGTTCACAGCAGGCATTAACCTCGAGGTTAATGCCTGCTGTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028194.2-9692s21c1
Sequence:CCGGACCCTTGTGCTTCATTGATAACTCGAGTTATCAATGAAGCACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028194.2-8333s21c1
Sequence:CCGGGACGAAGGGTCATACGTTATTCTCGAGAATAACGTATGACCCTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028194
VALIDATED
FRYL MISSION shRNA Lentiviral Transduction Particles
FRY-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028194.1-583s1c1
Sequence:CCGGGCAGTCAAATGCAGAAGGAATCTCGAGATTCCTTCTGCATTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028194.2-3542s21c1
Sequence:CCGGGTACAGCTGGTACGGATATTTCTCGAGAAATATCCGTACCAGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028194.2-6484s1c1
Sequence:CCGGCATAACGGATGGACGGATAAACTCGAGTTTATCCGTCCATCCGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028194.2-6485s21c1
Sequence:CCGGATAACGGATGGACGGATAAACCTCGAGGTTTATCCGTCCATCCGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028194.2-5666s21c1
Sequence:CCGGACGTTCACAGCAGGCATTAACCTCGAGGTTAATGCCTGCTGTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028194.2-9692s21c1
Sequence:CCGGACCCTTGTGCTTCATTGATAACTCGAGTTATCAATGAAGCACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028194.2-8333s21c1
Sequence:CCGGGACGAAGGGTCATACGTTATTCTCGAGAATAACGTATGACCCTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015030
VALIDATED
FRYL MISSION shRNA Bacterial Glycerol Stock
FRY-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015030.1-5651s21c1
Sequence:CCGGAGTTGCACACTTAGATTATAACTCGAGTTATAATCTAAGTGTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015030.1-3545s21c1
Sequence:CCGGAGTACAACTGGTACGAATATTCTCGAGAATATTCGTACCAGTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015030.1-10909s21c1
Sequence:CCGGTGTCTAAGTCTGTAGTATAACCTCGAGGTTATACTACAGACTTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015030.1-5001s21c1
Sequence:CCGGCGCATCACTTCCAGCTATAAACTCGAGTTTATAGCTGGAAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015030.1-3738s21c1
Sequence:CCGGAGTGCCTTAGTGGCGAATATTCTCGAGAATATTCGCCACTAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015030
VALIDATED
FRYL MISSION shRNA shRNA Plasmid DNA
FRY-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015030.1-5651s21c1
Sequence:CCGGAGTTGCACACTTAGATTATAACTCGAGTTATAATCTAAGTGTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015030.1-3545s21c1
Sequence:CCGGAGTACAACTGGTACGAATATTCTCGAGAATATTCGTACCAGTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015030.1-10909s21c1
Sequence:CCGGTGTCTAAGTCTGTAGTATAACCTCGAGGTTATACTACAGACTTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015030.1-5001s21c1
Sequence:CCGGCGCATCACTTCCAGCTATAAACTCGAGTTTATAGCTGGAAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015030.1-3738s21c1
Sequence:CCGGAGTGCCTTAGTGGCGAATATTCTCGAGAATATTCGCCACTAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015030
VALIDATED
FRYL MISSION shRNA Lentiviral Transduction Particles
FRY-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015030.1-5651s21c1
Sequence:CCGGAGTTGCACACTTAGATTATAACTCGAGTTATAATCTAAGTGTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015030.1-3545s21c1
Sequence:CCGGAGTACAACTGGTACGAATATTCTCGAGAATATTCGTACCAGTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015030.1-10909s21c1
Sequence:CCGGTGTCTAAGTCTGTAGTATAACCTCGAGGTTATACTACAGACTTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015030.1-5001s21c1
Sequence:CCGGCGCATCACTTCCAGCTATAAACTCGAGTTTATAGCTGGAAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015030.1-3738s21c1
Sequence:CCGGAGTGCCTTAGTGGCGAATATTCTCGAGAATATTCGCCACTAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks