EMAIL THIS PAGE TO A FRIEND

FRZB

frizzled-related protein

116 Gene Product Result for
Synonyms: FRE FRITZ FRP-3 FRZB-1 FRZB-PEN FRZB1 FZRB OS1 SFRP3 SRFP3 hFIZ
UniProtKB ID: Q92765, O00181, Q99686
Gene ID:
Human(2487) Summary: The protein encoded by this gene is a secreted protein that is involved in the regulation of bone development. Defects in this gene are a cause of female-specific osteoarthritis (OA) susceptibility. [provided by RefSeq, Apr 2010]
Mouse(20378) frizzled-related protein
Rat(295691) frizzled-related protein
sheep(101118419) frizzled-related protein
Domestic Rabbit(100008629) frizzled-related protein
domestic guinea pig(100716120) frizzled-related protein
naked mole-rat(101719944) frizzled-related protein
Zebrafish(30119) frizzled-related protein
chicken(395545) frizzled-related protein
domestic cat(101083786) frizzled-related protein
cow(281170) frizzled-related protein
dog(478827) frizzled-related protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101104 Anti-FRZB (311-325) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1412257 ANTI-FRZB antibody produced in mouse clone 4D12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412258 ANTI-FRZB antibody produced in mouse clone 3F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412259 ANTI-FRZB antibody produced in mouse clone 3C3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412260 ANTI-FRZB antibody produced in mouse clone 4B8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412480 ANTI-FRZB antibody produced in mouse clone 4E5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1410455 Anti-FRZB antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
WH0002487M1 Monoclonal Anti-FRZB antibody produced in mouse clone 4F7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403840 Monoclonal Anti-FRZB antibody produced in mouse clone 1H8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001463 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011356 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011356 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011356 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001463 Rosetta Predictions human pricing
NM_001100527 Rosetta Predictions rat pricing
NM_011356 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331903 predicted 803
2 SASI_Hs01_00240162 predicted 1045
3 SASI_Hs01_00240163 predicted 1183
4 SASI_Hs01_00240164 predicted 998
5 SASI_Hs01_00240165 predicted 787
6 SASI_Hs01_00240166 predicted 1270
7 SASI_Hs01_00240167 predicted 882
8 SASI_Hs01_00240168 predicted 774
9 SASI_Hs01_00240169 predicted 1119
10 SASI_Hs01_00240170 predicted 1080
11 SASI_Hs01_00240171 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209964 predicted 968
2 SASI_Rn02_00209965 predicted 1122
3 SASI_Rn02_00209966 predicted 952
4 SASI_Rn02_00209967 predicted 938
5 SASI_Rn02_00209968 predicted 1059
6 SASI_Rn02_00209969 predicted 1042
7 SASI_Rn02_00209970 predicted 974
8 SASI_Rn02_00209971 predicted 1346
9 SASI_Rn02_00209972 predicted 973
10 SASI_Rn02_00209973 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107641 predicted 1519
2 SASI_Mm01_00107642 predicted 1355
3 SASI_Mm01_00107643 predicted 1140
4 SASI_Mm01_00107644 predicted 1125
5 SASI_Mm01_00107645 predicted 1115
6 SASI_Mm01_00107646 predicted 1297
7 SASI_Mm02_00320511 predicted 1336
8 SASI_Mm01_00107647 predicted 1206
9 SASI_Mm01_00107648 predicted 1218
10 SASI_Mm01_00107649 predicted 1153
11 SASI_Mm01_00107650 predicted 1378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001463
FRZB MISSION shRNA Bacterial Glycerol Stock
frizzled-related protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001463.2-1187s21c1
Sequence:CCGGACGCAACTAAATCCCGAAATACTCGAGTATTTCGGGATTTAGTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001463.2-1274s21c1
Sequence:CCGGGCACTATTGCACATCATATTCCTCGAGGAATATGATGTGCAATAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001463.2-1098s1c1
Sequence:CCGGCGTCATCTTGGACTCAGTAAACTCGAGTTTACTGAGTCCAAGATGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001463.2-957s1c1
Sequence:CCGGCCACTTAATGTTAATGAGGAACTCGAGTTCCTCATTAACATTAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001463.2-356s1c1
Sequence:CCGGGCCCTGGAACATGACTAAGATCTCGAGATCTTAGTCATGTTCCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001463.2-747s1c1
Sequence:CCGGCGCTGTAAATGTAAGCCTATTCTCGAGAATAGGCTTACATTTACAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001463.2-1617s1c1
Sequence:CCGGCCGATCTAATTACAGCCTTATCTCGAGATAAGGCTGTAATTAGATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001463
FRZB MISSION shRNA shRNA Plasmid DNA
frizzled-related protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001463.2-1187s21c1
Sequence:CCGGACGCAACTAAATCCCGAAATACTCGAGTATTTCGGGATTTAGTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001463.2-1274s21c1
Sequence:CCGGGCACTATTGCACATCATATTCCTCGAGGAATATGATGTGCAATAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001463.2-1098s1c1
Sequence:CCGGCGTCATCTTGGACTCAGTAAACTCGAGTTTACTGAGTCCAAGATGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001463.2-957s1c1
Sequence:CCGGCCACTTAATGTTAATGAGGAACTCGAGTTCCTCATTAACATTAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001463.2-356s1c1
Sequence:CCGGGCCCTGGAACATGACTAAGATCTCGAGATCTTAGTCATGTTCCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001463.2-747s1c1
Sequence:CCGGCGCTGTAAATGTAAGCCTATTCTCGAGAATAGGCTTACATTTACAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001463.2-1617s1c1
Sequence:CCGGCCGATCTAATTACAGCCTTATCTCGAGATAAGGCTGTAATTAGATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001463
FRZB MISSION shRNA Lentiviral Transduction Particles
frizzled-related protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001463.2-1187s21c1
Sequence:CCGGACGCAACTAAATCCCGAAATACTCGAGTATTTCGGGATTTAGTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001463.2-1274s21c1
Sequence:CCGGGCACTATTGCACATCATATTCCTCGAGGAATATGATGTGCAATAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001463.2-1098s1c1
Sequence:CCGGCGTCATCTTGGACTCAGTAAACTCGAGTTTACTGAGTCCAAGATGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001463.2-957s1c1
Sequence:CCGGCCACTTAATGTTAATGAGGAACTCGAGTTCCTCATTAACATTAAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001463.2-356s1c1
Sequence:CCGGGCCCTGGAACATGACTAAGATCTCGAGATCTTAGTCATGTTCCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001463.2-747s1c1
Sequence:CCGGCGCTGTAAATGTAAGCCTATTCTCGAGAATAGGCTTACATTTACAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001463.2-1617s1c1
Sequence:CCGGCCGATCTAATTACAGCCTTATCTCGAGATAAGGCTGTAATTAGATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011356
VALIDATED
FRZB MISSION shRNA Bacterial Glycerol Stock
frizzled-related protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011356.2-1297s1c1
Sequence:CCGGCCACTTACTGTCAATGAGGAACTCGAGTTCCTCATTGACAGTAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011356.2-1171s1c1
Sequence:CCGGGAGGTAAAGATGAAATGTCATCTCGAGATGACATTTCATCTTTACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011356.2-1465s1c1
Sequence:CCGGGCTAGCGATTCCACTCAGAATCTCGAGATTCTGAGTGGAATCGCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011356.2-1143s1c1
Sequence:CCGGCAACTATGTCATCCGGGCTAACTCGAGTTAGCCCGGATGACATAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011356.2-1426s1c1
Sequence:CCGGGATATGAAACTCCGACACCTTCTCGAGAAGGTGTCGGAGTTTCATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011356
VALIDATED
FRZB MISSION shRNA shRNA Plasmid DNA
frizzled-related protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011356.2-1297s1c1
Sequence:CCGGCCACTTACTGTCAATGAGGAACTCGAGTTCCTCATTGACAGTAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011356.2-1171s1c1
Sequence:CCGGGAGGTAAAGATGAAATGTCATCTCGAGATGACATTTCATCTTTACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011356.2-1465s1c1
Sequence:CCGGGCTAGCGATTCCACTCAGAATCTCGAGATTCTGAGTGGAATCGCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011356.2-1143s1c1
Sequence:CCGGCAACTATGTCATCCGGGCTAACTCGAGTTAGCCCGGATGACATAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011356.2-1426s1c1
Sequence:CCGGGATATGAAACTCCGACACCTTCTCGAGAAGGTGTCGGAGTTTCATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011356
VALIDATED
FRZB MISSION shRNA Lentiviral Transduction Particles
frizzled-related protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011356.2-1297s1c1
Sequence:CCGGCCACTTACTGTCAATGAGGAACTCGAGTTCCTCATTGACAGTAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011356.2-1171s1c1
Sequence:CCGGGAGGTAAAGATGAAATGTCATCTCGAGATGACATTTCATCTTTACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011356.2-1465s1c1
Sequence:CCGGGCTAGCGATTCCACTCAGAATCTCGAGATTCTGAGTGGAATCGCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011356.2-1143s1c1
Sequence:CCGGCAACTATGTCATCCGGGCTAACTCGAGTTAGCCCGGATGACATAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011356.2-1426s1c1
Sequence:CCGGGATATGAAACTCCGACACCTTCTCGAGAAGGTGTCGGAGTTTCATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)