EMAIL THIS PAGE TO A FRIEND

FSCB

fibrous sheath CABYR binding protein

61 Gene Product Result for
Synonyms: C14orf155
UniProtKB ID: Q5H9T9, Q5H9U7, Q86YI2, Q9H0J3
Gene ID:
Mouse(623046) fibrous sheath CABYR binding protein
Rat(500659) fibrous sheath CABYR binding protein
cow(767821) fibrous sheath CABYR binding protein
dog(100684231) fibrous sheath CABYR binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032135 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032135 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032135 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001163271 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163271 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163271 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032135 Rosetta Predictions human pricing
XM_001080022 Rosetta Predictions rat pricing
XM_576037 Rosetta Predictions rat pricing
XM_887483 Rosetta Predictions mouse pricing
XM_916221 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359359 predicted 748
2 SASI_Hs01_00089239 predicted 398
3 SASI_Hs01_00089241 predicted 458
4 SASI_Hs01_00089243 predicted 2526
5 SASI_Hs01_00089244 predicted 996
6 SASI_Hs01_00089245 predicted 1140
7 SASI_Hs01_00089246 predicted 470
8 SASI_Hs01_00089247 predicted 337
9 SASI_Hs01_00089248 predicted 1955
10 SASI_Hs02_00359360 predicted 617
11 SASI_Hs01_00089240 predicted 1452
12 SASI_Hs01_00089242 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366268 predicted 1960
2 SASI_Rn02_00366269 predicted 2472
3 SASI_Rn02_00366270 predicted 2468
4 SASI_Rn02_00366271 predicted 699
5 SASI_Rn02_00366272 predicted 1912
6 SASI_Rn02_00366273 predicted 441
7 SASI_Rn02_00366274 predicted 371
8 SASI_Rn02_00366275 predicted 1405
9 SASI_Rn02_00366276 predicted 741
10 SASI_Rn02_00366277 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576037 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404649 predicted 1730
2 SASI_Rn02_00404650 predicted 2327
3 SASI_Rn02_00404651 predicted 1956
4 SASI_Rn02_00404652 predicted 2479
5 SASI_Rn02_00404653 predicted 2472
6 SASI_Rn02_00404654 predicted 1907
7 SASI_Rn02_00404655 predicted 368
8 SASI_Rn02_00404656 predicted 2250
9 SASI_Rn02_00404657 predicted 2061
10 SASI_Rn02_00404658 predicted 1891
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_887483 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238167 predicted 1309
2 SASI_Mm01_00238168 predicted 2002
3 SASI_Mm01_00238169 predicted 2596
4 SASI_Mm01_00238170 predicted 486
5 SASI_Mm02_00428488 predicted 1815
6 SASI_Mm01_00238173 predicted 702
7 SASI_Mm01_00238174 predicted 465
8 SASI_Mm01_00238175 predicted 2833
9 SASI_Mm01_00238176 predicted 2513
10 SASI_Mm01_00238171 predicted 2871
11 SASI_Mm01_00238172 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916221 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440179 predicted 1312
2 SASI_Mm02_00440180 predicted 1996
3 SASI_Mm02_00440181 predicted 2630
4 SASI_Mm02_00440182 predicted 481
5 SASI_Mm02_00440183 predicted 1816
6 SASI_Mm02_00440184 predicted 707
7 SASI_Mm02_00440185 predicted 471
8 SASI_Mm02_00440186 predicted 2871
9 SASI_Mm02_00440187 predicted 2546
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032135
FSCB MISSION shRNA Bacterial Glycerol Stock
fibrous sheath CABYR binding protein
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032135.2-396s1c1
Sequence:CCGGCCAAAGCCTATGAGTCTATTACTCGAGTAATAGACTCATAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032135.2-1784s1c1
Sequence:CCGGGCTGAAGTTCAATCTCCATTACTCGAGTAATGGAGATTGAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149917    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032135.2-2766s1c1
Sequence:CCGGGCAATCAGAAGCTACATGGTTCTCGAGAACCATGTAGCTTCTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032135.2-1031s1c1
Sequence:CCGGGCTGAAATAGAGCCTCCATCACTCGAGTGATGGAGGCTCTATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032135.2-2681s1c1
Sequence:CCGGGCTCCCACTCTTGAAATAGAACTCGAGTTCTATTTCAAGAGTGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128910    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032135.2-2762s1c1
Sequence:CCGGGCTAGCAATCAGAAGCTACATCTCGAGATGTAGCTTCTGATTGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032135.2-2820s1c1
Sequence:CCGGCGGGAAGTAGCTTTGTCAATACTCGAGTATTGACAAAGCTACTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032135.3-1440s21c1
Sequence:CCGGAGTAGAGCTTCTTGGTGAAATCTCGAGATTTCACCAAGAAGCTCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032135.3-669s21c1
Sequence:CCGGCATACCTTCAGTTCAACTAAACTCGAGTTTAGTTGAACTGAAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032135.3-767s21c1
Sequence:CCGGAGGAACAACAGACATACTTTACTCGAGTAAAGTATGTCTGTTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032135.3-883s21c1
Sequence:CCGCGCTAGTGAACACCCTGAATTTCTCGAGAAATTCAGGGTGTTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032135.3-1574s21c1
Sequence:CCGGCTGATGTTCAGCCTCTATTACCTCGAGGTAATAGAGGCTGAACATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032135
FSCB MISSION shRNA shRNA Plasmid DNA
fibrous sheath CABYR binding protein
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032135.2-396s1c1
Sequence:CCGGCCAAAGCCTATGAGTCTATTACTCGAGTAATAGACTCATAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032135.2-1784s1c1
Sequence:CCGGGCTGAAGTTCAATCTCCATTACTCGAGTAATGGAGATTGAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149917    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032135.2-2766s1c1
Sequence:CCGGGCAATCAGAAGCTACATGGTTCTCGAGAACCATGTAGCTTCTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032135.2-1031s1c1
Sequence:CCGGGCTGAAATAGAGCCTCCATCACTCGAGTGATGGAGGCTCTATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032135.2-2681s1c1
Sequence:CCGGGCTCCCACTCTTGAAATAGAACTCGAGTTCTATTTCAAGAGTGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128910    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032135.2-2762s1c1
Sequence:CCGGGCTAGCAATCAGAAGCTACATCTCGAGATGTAGCTTCTGATTGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032135.2-2820s1c1
Sequence:CCGGCGGGAAGTAGCTTTGTCAATACTCGAGTATTGACAAAGCTACTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032135.3-1440s21c1
Sequence:CCGGAGTAGAGCTTCTTGGTGAAATCTCGAGATTTCACCAAGAAGCTCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032135.3-669s21c1
Sequence:CCGGCATACCTTCAGTTCAACTAAACTCGAGTTTAGTTGAACTGAAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032135.3-767s21c1
Sequence:CCGGAGGAACAACAGACATACTTTACTCGAGTAAAGTATGTCTGTTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032135.3-883s21c1
Sequence:CCGCGCTAGTGAACACCCTGAATTTCTCGAGAAATTCAGGGTGTTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032135.3-1574s21c1
Sequence:CCGGCTGATGTTCAGCCTCTATTACCTCGAGGTAATAGAGGCTGAACATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032135
FSCB MISSION shRNA Lentiviral Transduction Particles
fibrous sheath CABYR binding protein
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032135.2-396s1c1
Sequence:CCGGCCAAAGCCTATGAGTCTATTACTCGAGTAATAGACTCATAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032135.2-1784s1c1
Sequence:CCGGGCTGAAGTTCAATCTCCATTACTCGAGTAATGGAGATTGAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149917    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032135.2-2766s1c1
Sequence:CCGGGCAATCAGAAGCTACATGGTTCTCGAGAACCATGTAGCTTCTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032135.2-1031s1c1
Sequence:CCGGGCTGAAATAGAGCCTCCATCACTCGAGTGATGGAGGCTCTATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032135.2-2681s1c1
Sequence:CCGGGCTCCCACTCTTGAAATAGAACTCGAGTTCTATTTCAAGAGTGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128910    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032135.2-2762s1c1
Sequence:CCGGGCTAGCAATCAGAAGCTACATCTCGAGATGTAGCTTCTGATTGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032135.2-2820s1c1
Sequence:CCGGCGGGAAGTAGCTTTGTCAATACTCGAGTATTGACAAAGCTACTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032135.3-1440s21c1
Sequence:CCGGAGTAGAGCTTCTTGGTGAAATCTCGAGATTTCACCAAGAAGCTCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032135.3-669s21c1
Sequence:CCGGCATACCTTCAGTTCAACTAAACTCGAGTTTAGTTGAACTGAAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032135.3-767s21c1
Sequence:CCGGAGGAACAACAGACATACTTTACTCGAGTAAAGTATGTCTGTTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032135.3-883s21c1
Sequence:CCGCGCTAGTGAACACCCTGAATTTCTCGAGAAATTCAGGGTGTTCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032135.3-1574s21c1
Sequence:CCGGCTGATGTTCAGCCTCTATTACCTCGAGGTAATAGAGGCTGAACATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163271
FSCB MISSION shRNA Bacterial Glycerol Stock
fibrous sheath CABYR binding protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163271.1-2840s21c1
Sequence:CCGGATTCTACAAACTGACGATATTCTCGAGAATATCGTCAGTTTGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163271.1-362s21c1
Sequence:CCGGCCTAAAGCTACTCATAGTATTCTCGAGAATACTATGAGTAGCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163271.1-3196s21c1
Sequence:CCGGTGCAGATCAGGTTCTACTAAACTCGAGTTTAGTAGAACCTGATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163271.1-2786s21c1
Sequence:CCGGGCTGTTCATCCTTCGTCATTACTCGAGTAATGACGAAGGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163271.1-1128s21c1
Sequence:CCGGTAGAGGCTCCTGCTGATATTACTCGAGTAATATCAGCAGGAGCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163271
FSCB MISSION shRNA shRNA Plasmid DNA
fibrous sheath CABYR binding protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163271.1-2840s21c1
Sequence:CCGGATTCTACAAACTGACGATATTCTCGAGAATATCGTCAGTTTGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163271.1-362s21c1
Sequence:CCGGCCTAAAGCTACTCATAGTATTCTCGAGAATACTATGAGTAGCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163271.1-3196s21c1
Sequence:CCGGTGCAGATCAGGTTCTACTAAACTCGAGTTTAGTAGAACCTGATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163271.1-2786s21c1
Sequence:CCGGGCTGTTCATCCTTCGTCATTACTCGAGTAATGACGAAGGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163271.1-1128s21c1
Sequence:CCGGTAGAGGCTCCTGCTGATATTACTCGAGTAATATCAGCAGGAGCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163271
FSCB MISSION shRNA Lentiviral Transduction Particles
fibrous sheath CABYR binding protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163271.1-2840s21c1
Sequence:CCGGATTCTACAAACTGACGATATTCTCGAGAATATCGTCAGTTTGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163271.1-362s21c1
Sequence:CCGGCCTAAAGCTACTCATAGTATTCTCGAGAATACTATGAGTAGCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163271.1-3196s21c1
Sequence:CCGGTGCAGATCAGGTTCTACTAAACTCGAGTTTAGTAGAACCTGATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163271.1-2786s21c1
Sequence:CCGGGCTGTTCATCCTTCGTCATTACTCGAGTAATGACGAAGGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163271.1-1128s21c1
Sequence:CCGGTAGAGGCTCCTGCTGATATTACTCGAGTAATATCAGCAGGAGCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks