EMAIL THIS PAGE TO A FRIEND

FSCN1

fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)

70 Gene Product Result for
Synonyms: FAN1 HSN SNL p55
UniProtKB ID: Q16658, A6NI89, B2RE97, Q96IC5, Q9BRF1
Gene ID:
Human(6624) Summary: This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15. [provided by RefSeq, Sep 2011]
Mouse(14086) fascin homolog 1, actin bundling protein (Strongylocentrotus purpuratus)
Rat(683788) fascin homolog 1, actin bundling protein (Strongylocentrotus purpuratus)
chicken(416485) fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)
dog(489880) fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)
cow(507342) fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)
domestic cat(101098761) fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)
domestic guinea pig(100733694) fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)
naked mole-rat(101716557) fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)
sheep(101108186) fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007984 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007984 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007984 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003088 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003088 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003088 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003088 Rosetta Predictions human pricing
NM_001100806 Rosetta Predictions rat pricing
NM_007984 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222012 predicted 1155
2 SASI_Hs01_00222013 predicted 1283
3 SASI_Hs01_00222015 predicted 517
4 SASI_Hs01_00222016 predicted 536
5 SASI_Hs01_00222017 predicted 940
6 SASI_Hs02_00335023 predicted 938
7 SASI_Hs02_00335024 predicted 1105
8 SASI_Hs02_00335025 predicted 742
9 SASI_Hs02_00335026 predicted 374
10 SASI_Hs02_00335027 predicted 1099
11 SASI_Hs01_00222014 predicted 932
12 SASI_Hs01_00222018 predicted 496
13 SASI_Hs01_00222019 predicted 773
14 SASI_Hs01_00222020 predicted 473
15 SASI_Hs01_00222021 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100806 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210612 predicted 727
2 SASI_Rn02_00210613 predicted 487
3 SASI_Rn02_00210614 predicted 1634
4 SASI_Rn02_00210615 predicted 1188
5 SASI_Rn02_00210616 predicted 1070
6 SASI_Rn02_00210617 predicted 278
7 SASI_Rn02_00210618 predicted 1116
8 SASI_Rn02_00210619 predicted 1013
9 SASI_Rn02_00210620 predicted 1252
10 SASI_Rn02_00210621 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007984 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199481 predicted 744
2 SASI_Mm02_00312893 predicted 1264
3 SASI_Mm01_00199483 predicted 1320
4 SASI_Mm01_00199484 predicted 513
5 SASI_Mm01_00199485 predicted 523
6 SASI_Mm01_00199486 predicted 291
7 SASI_Mm01_00199487 predicted 1127
8 SASI_Mm01_00199488 predicted 980
9 SASI_Mm01_00199489 predicted 748
10 SASI_Mm01_00199490 predicted 1089
11 SASI_Mm01_00199482 predicted 1191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007984
VALIDATED
FSCN1 MISSION shRNA Bacterial Glycerol Stock
fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007984.2-1220s21c1
Sequence:CCGGTTCCTCATGAAGCTGATTAACCTCGAGGTTAATCAGCTTCATGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007984.2-1083s21c1
Sequence:CCGGAGAACGCCAGCTGCTACTTTGCTCGAGCAAAGTAGCAGCTGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007984.2-197s21c1
Sequence:CCGGGCATCCGCTAGTAGCTTGAAACTCGAGTTTCAAGCTACTAGCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007984.2-1612s21c1
Sequence:CCGGCCTCCTGTTATCCTTACTCATCTCGAGATGAGTAAGGATAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007984.2-1315s21c1
Sequence:CCGGCCGTTCCAGTTACGATGTCTTCTCGAGAAGACATCGTAACTGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007984.2-1465s21c1
Sequence:CCGGCTACAATAAGGTGGCTCTCAACTCGAGTTGAGAGCCACCTTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007984.1-1449s1c1
Sequence:CCGGCTACAATAAGGTGGCTCTCAACTCGAGTTGAGAGCCACCTTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007984.1-181s1c1
Sequence:CCGGGCATCCGCTAGTAGCTTGAAACTCGAGTTTCAAGCTACTAGCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007984.1-1299s1c1
Sequence:CCGGCCGTTCCAGTTACGATGTCTTCTCGAGAAGACATCGTAACTGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007984.1-978s1c1
Sequence:CCGGCGACACAAGAAAGTGTGCCTTCTCGAGAAGGCACACTTTCTTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007984.1-1593s1c1
Sequence:CCGGCCTCCTGTTATCCTTACTCATCTCGAGATGAGTAAGGATAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007984
VALIDATED
FSCN1 MISSION shRNA shRNA Plasmid DNA
fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007984.2-1220s21c1
Sequence:CCGGTTCCTCATGAAGCTGATTAACCTCGAGGTTAATCAGCTTCATGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007984.2-1083s21c1
Sequence:CCGGAGAACGCCAGCTGCTACTTTGCTCGAGCAAAGTAGCAGCTGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007984.2-197s21c1
Sequence:CCGGGCATCCGCTAGTAGCTTGAAACTCGAGTTTCAAGCTACTAGCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007984.2-1612s21c1
Sequence:CCGGCCTCCTGTTATCCTTACTCATCTCGAGATGAGTAAGGATAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007984.2-1315s21c1
Sequence:CCGGCCGTTCCAGTTACGATGTCTTCTCGAGAAGACATCGTAACTGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007984.2-1465s21c1
Sequence:CCGGCTACAATAAGGTGGCTCTCAACTCGAGTTGAGAGCCACCTTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007984.1-1449s1c1
Sequence:CCGGCTACAATAAGGTGGCTCTCAACTCGAGTTGAGAGCCACCTTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007984.1-181s1c1
Sequence:CCGGGCATCCGCTAGTAGCTTGAAACTCGAGTTTCAAGCTACTAGCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007984.1-1299s1c1
Sequence:CCGGCCGTTCCAGTTACGATGTCTTCTCGAGAAGACATCGTAACTGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007984.1-978s1c1
Sequence:CCGGCGACACAAGAAAGTGTGCCTTCTCGAGAAGGCACACTTTCTTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007984.1-1593s1c1
Sequence:CCGGCCTCCTGTTATCCTTACTCATCTCGAGATGAGTAAGGATAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007984
VALIDATED
FSCN1 MISSION shRNA Lentiviral Transduction Particles
fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007984.2-1220s21c1
Sequence:CCGGTTCCTCATGAAGCTGATTAACCTCGAGGTTAATCAGCTTCATGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007984.2-1083s21c1
Sequence:CCGGAGAACGCCAGCTGCTACTTTGCTCGAGCAAAGTAGCAGCTGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007984.2-197s21c1
Sequence:CCGGGCATCCGCTAGTAGCTTGAAACTCGAGTTTCAAGCTACTAGCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007984.2-1612s21c1
Sequence:CCGGCCTCCTGTTATCCTTACTCATCTCGAGATGAGTAAGGATAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007984.2-1315s21c1
Sequence:CCGGCCGTTCCAGTTACGATGTCTTCTCGAGAAGACATCGTAACTGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007984.2-1465s21c1
Sequence:CCGGCTACAATAAGGTGGCTCTCAACTCGAGTTGAGAGCCACCTTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007984.1-1449s1c1
Sequence:CCGGCTACAATAAGGTGGCTCTCAACTCGAGTTGAGAGCCACCTTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007984.1-181s1c1
Sequence:CCGGGCATCCGCTAGTAGCTTGAAACTCGAGTTTCAAGCTACTAGCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007984.1-1299s1c1
Sequence:CCGGCCGTTCCAGTTACGATGTCTTCTCGAGAAGACATCGTAACTGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007984.1-978s1c1
Sequence:CCGGCGACACAAGAAAGTGTGCCTTCTCGAGAAGGCACACTTTCTTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007984.1-1593s1c1
Sequence:CCGGCCTCCTGTTATCCTTACTCATCTCGAGATGAGTAAGGATAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003088
VALIDATED
FSCN1 MISSION shRNA Bacterial Glycerol Stock
fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003088.2-1482s21c1
Sequence:CCGGCGACTATAACAAGGTGGCCATCTCGAGATGGCCACCTTGTTATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003088.2-1699s21c1
Sequence:CCGGCCCTTGCCTTTCAAACTGGAACTCGAGTTCCAGTTTGAAAGGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003088.2-1170s21c1
Sequence:CCGGCAAGTTTGTGACCTCCAAGAACTCGAGTTCTTGGAGGTCACAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003088.2-1112s21c1
Sequence:CCGGGCTGCTACTTTGACATCGAGTCTCGAGACTCGATGTCAAAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003088.2-1699s1c1
Sequence:CCGGCCCTTGCCTTTCAAACTGGAACTCGAGTTCCAGTTTGAAAGGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003088.2-1170s1c1
Sequence:CCGGCAAGTTTGTGACCTCCAAGAACTCGAGTTCTTGGAGGTCACAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003088.2-1482s1c1
Sequence:CCGGCGACTATAACAAGGTGGCCATCTCGAGATGGCCACCTTGTTATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003088.2-1112s1c1
Sequence:CCGGGCTGCTACTTTGACATCGAGTCTCGAGACTCGATGTCAAAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003088.2-156s1c1
Sequence:CCGGCGGCCTCATCAACTGCGGCAACTCGAGTTGCCGCAGTTGATGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003088
VALIDATED
FSCN1 MISSION shRNA shRNA Plasmid DNA
fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003088.2-1482s21c1
Sequence:CCGGCGACTATAACAAGGTGGCCATCTCGAGATGGCCACCTTGTTATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003088.2-1699s21c1
Sequence:CCGGCCCTTGCCTTTCAAACTGGAACTCGAGTTCCAGTTTGAAAGGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003088.2-1170s21c1
Sequence:CCGGCAAGTTTGTGACCTCCAAGAACTCGAGTTCTTGGAGGTCACAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003088.2-1112s21c1
Sequence:CCGGGCTGCTACTTTGACATCGAGTCTCGAGACTCGATGTCAAAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003088.2-1699s1c1
Sequence:CCGGCCCTTGCCTTTCAAACTGGAACTCGAGTTCCAGTTTGAAAGGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003088.2-1170s1c1
Sequence:CCGGCAAGTTTGTGACCTCCAAGAACTCGAGTTCTTGGAGGTCACAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003088.2-1482s1c1
Sequence:CCGGCGACTATAACAAGGTGGCCATCTCGAGATGGCCACCTTGTTATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003088.2-1112s1c1
Sequence:CCGGGCTGCTACTTTGACATCGAGTCTCGAGACTCGATGTCAAAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003088.2-156s1c1
Sequence:CCGGCGGCCTCATCAACTGCGGCAACTCGAGTTGCCGCAGTTGATGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003088
VALIDATED
FSCN1 MISSION shRNA Lentiviral Transduction Particles
fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003088.2-1482s21c1
Sequence:CCGGCGACTATAACAAGGTGGCCATCTCGAGATGGCCACCTTGTTATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003088.2-1699s21c1
Sequence:CCGGCCCTTGCCTTTCAAACTGGAACTCGAGTTCCAGTTTGAAAGGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003088.2-1170s21c1
Sequence:CCGGCAAGTTTGTGACCTCCAAGAACTCGAGTTCTTGGAGGTCACAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003088.2-1112s21c1
Sequence:CCGGGCTGCTACTTTGACATCGAGTCTCGAGACTCGATGTCAAAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003088.2-1699s1c1
Sequence:CCGGCCCTTGCCTTTCAAACTGGAACTCGAGTTCCAGTTTGAAAGGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003088.2-1170s1c1
Sequence:CCGGCAAGTTTGTGACCTCCAAGAACTCGAGTTCTTGGAGGTCACAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003088.2-1482s1c1
Sequence:CCGGCGACTATAACAAGGTGGCCATCTCGAGATGGCCACCTTGTTATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003088.2-1112s1c1
Sequence:CCGGGCTGCTACTTTGACATCGAGTCTCGAGACTCGATGTCAAAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003088.2-156s1c1
Sequence:CCGGCGGCCTCATCAACTGCGGCAACTCGAGTTGCCGCAGTTGATGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks