EMAIL THIS PAGE TO A FRIEND

FSCN2

fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)

55 Gene Product Result for
Synonyms: RFSN RP30
UniProtKB ID: O14926, A0AVC4, A8MRA6
Gene ID:
Human(25794) Summary: This gene encodes a member of the fascin protein family. Fascins crosslink actin into filamentous bundles within dynamic cell extensions. This family member is proposed to play a role in photoreceptor disk morphogenesis. A mutation in this gene results in one form of autosomal dominant retinitis pigmentosa and macular degeneration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(238021) fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)
Rat(303741) fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)
chicken(429198) fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)
dog(483362) fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)
cow(337926) fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)
domestic cat(101088198) fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)
sheep(101118036) fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)
naked mole-rat(101703093) fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)
domestic guinea pig(100731990) fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501809 Anti-FSCN2 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, mouse, human, rat
ELISA, immunohistochemistry pricing
SAB2107454 Anti-FSCN2 antibody produced in rabbit affinity isolated antibody horse, guinea pig, rabbit, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012418 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172802 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172802 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172802 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU062101 MISSION® esiRNA esiRNA targeting mouse Fscn2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077182 Rosetta Predictions human pricing
NM_012418 Rosetta Predictions human pricing
NM_001107072 Rosetta Predictions rat pricing
NM_172802 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312094 predicted 946
2 SASI_Hs02_00312095 predicted 979
3 SASI_Hs02_00312096 predicted 208
4 SASI_Hs02_00312097 predicted 763
5 SASI_Hs02_00312098 predicted 786
6 SASI_Hs02_00312099 predicted 487
7 SASI_Hs02_00312100 predicted 214
8 SASI_Hs02_00312101 predicted 1004
9 SASI_Hs02_00312102 predicted 843
10 SASI_Hs02_00312103 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192274 predicted 945
2 SASI_Hs01_00192275 predicted 979
3 SASI_Hs01_00192276 predicted 206
4 SASI_Hs02_00344280 predicted 759
5 SASI_Hs01_00192277 predicted 783
6 SASI_Hs01_00192278 predicted 482
7 SASI_Hs02_00344281 predicted 211
8 SASI_Hs02_00344282 predicted 1012
9 SASI_Hs01_00192280 predicted 850
10 SASI_Hs01_00192281 predicted 877
11 SASI_Hs01_00192279 predicted 1347
12 SASI_Hs01_00192282 predicted 973
13 SASI_Hs01_00192283 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107072 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225216 predicted 1151
2 SASI_Rn02_00225217 predicted 1207
3 SASI_Rn02_00225218 predicted 572
4 SASI_Rn02_00225219 predicted 790
5 SASI_Rn02_00225220 predicted 419
6 SASI_Rn02_00225221 predicted 1271
7 SASI_Rn02_00225222 predicted 234
8 SASI_Rn02_00225223 predicted 811
9 SASI_Rn02_00225224 predicted 868
10 SASI_Rn02_00225225 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172802 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167790 predicted 995
2 SASI_Mm01_00167791 predicted 1376
3 SASI_Mm02_00344718 predicted 1162
4 SASI_Mm01_00167793 predicted 1364
5 SASI_Mm01_00167794 predicted 823
6 SASI_Mm01_00167795 predicted 575
7 SASI_Mm01_00167796 predicted 961
8 SASI_Mm01_00167797 predicted 687
9 SASI_Mm01_00167799 predicted 1267
10 SASI_Mm02_00344719 predicted 244
11 SASI_Mm01_00167792 predicted 1166
12 SASI_Mm01_00167798 predicted 882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012418
FSCN2 MISSION shRNA Bacterial Glycerol Stock
fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012418.1-184s1c1
Sequence:CCGGCGTCAACGACACTGACCGCTACTCGAGTAGCGGTCAGTGTCGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012418.1-218s1c1
Sequence:CCGGAGCTTCGGCTTCAAGGTCAATCTCGAGATTGACCTTGAAGCCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012418.1-1033s1c1
Sequence:CCGGGACAAAGAAGTGCACCTTCTACTCGAGTAGAAGGTGCACTTCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012418.1-1189s1c1
Sequence:CCGGCTACGTGTGCATGAAGAAGAACTCGAGTTCTTCTTCATGCACACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012418.1-977s1c1
Sequence:CCGGGCCAATCAGGATGATGAACTACTCGAGTAGTTCATCATCCTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012418
FSCN2 MISSION shRNA shRNA Plasmid DNA
fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012418.1-184s1c1
Sequence:CCGGCGTCAACGACACTGACCGCTACTCGAGTAGCGGTCAGTGTCGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012418.1-218s1c1
Sequence:CCGGAGCTTCGGCTTCAAGGTCAATCTCGAGATTGACCTTGAAGCCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012418.1-1033s1c1
Sequence:CCGGGACAAAGAAGTGCACCTTCTACTCGAGTAGAAGGTGCACTTCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012418.1-1189s1c1
Sequence:CCGGCTACGTGTGCATGAAGAAGAACTCGAGTTCTTCTTCATGCACACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012418.1-977s1c1
Sequence:CCGGGCCAATCAGGATGATGAACTACTCGAGTAGTTCATCATCCTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012418
FSCN2 MISSION shRNA Lentiviral Transduction Particles
fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012418.1-184s1c1
Sequence:CCGGCGTCAACGACACTGACCGCTACTCGAGTAGCGGTCAGTGTCGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012418.1-218s1c1
Sequence:CCGGAGCTTCGGCTTCAAGGTCAATCTCGAGATTGACCTTGAAGCCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012418.1-1033s1c1
Sequence:CCGGGACAAAGAAGTGCACCTTCTACTCGAGTAGAAGGTGCACTTCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012418.1-1189s1c1
Sequence:CCGGCTACGTGTGCATGAAGAAGAACTCGAGTTCTTCTTCATGCACACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012418.1-977s1c1
Sequence:CCGGGCCAATCAGGATGATGAACTACTCGAGTAGTTCATCATCCTGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172802
FSCN2 MISSION shRNA Bacterial Glycerol Stock
fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172802.1-734s1c1
Sequence:CCGGCAAGTCTTATGACAGCCGCTACTCGAGTAGCGGCTGTCATAAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172802.1-1164s1c1
Sequence:CCGGGCCAACACCATGTTTGAAATACTCGAGTATTTCAAACATGGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172802.1-204s1c1
Sequence:CCGGCTGAAGATCCAGTTTGGCCTTCTCGAGAAGGCCAAACTGGATCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172802.1-809s1c1
Sequence:CCGGGCTGGAGTTCAAGGCAGGCAACTCGAGTTGCCTGCCTTGAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172802.1-1289s1c1
Sequence:CCGGCGAGCTATTTACCCTCAAGCTCTCGAGAGCTTGAGGGTAAATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172802.4-1425s21c1
Sequence:CCGGGGGATGGCGCCTATCAGATTACTCGAGTAATCTGATAGGCGCCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172802.4-584s21c1
Sequence:CCGGATCCACCCACAGGCTCATTTGCTCGAGCAAATGAGCCTGTGGGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172802
FSCN2 MISSION shRNA shRNA Plasmid DNA
fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172802.1-734s1c1
Sequence:CCGGCAAGTCTTATGACAGCCGCTACTCGAGTAGCGGCTGTCATAAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172802.1-1164s1c1
Sequence:CCGGGCCAACACCATGTTTGAAATACTCGAGTATTTCAAACATGGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172802.1-204s1c1
Sequence:CCGGCTGAAGATCCAGTTTGGCCTTCTCGAGAAGGCCAAACTGGATCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172802.1-809s1c1
Sequence:CCGGGCTGGAGTTCAAGGCAGGCAACTCGAGTTGCCTGCCTTGAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172802.1-1289s1c1
Sequence:CCGGCGAGCTATTTACCCTCAAGCTCTCGAGAGCTTGAGGGTAAATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172802.4-1425s21c1
Sequence:CCGGGGGATGGCGCCTATCAGATTACTCGAGTAATCTGATAGGCGCCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172802.4-584s21c1
Sequence:CCGGATCCACCCACAGGCTCATTTGCTCGAGCAAATGAGCCTGTGGGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172802
FSCN2 MISSION shRNA Lentiviral Transduction Particles
fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172802.1-734s1c1
Sequence:CCGGCAAGTCTTATGACAGCCGCTACTCGAGTAGCGGCTGTCATAAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172802.1-1164s1c1
Sequence:CCGGGCCAACACCATGTTTGAAATACTCGAGTATTTCAAACATGGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172802.1-204s1c1
Sequence:CCGGCTGAAGATCCAGTTTGGCCTTCTCGAGAAGGCCAAACTGGATCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172802.1-809s1c1
Sequence:CCGGGCTGGAGTTCAAGGCAGGCAACTCGAGTTGCCTGCCTTGAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172802.1-1289s1c1
Sequence:CCGGCGAGCTATTTACCCTCAAGCTCTCGAGAGCTTGAGGGTAAATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172802.4-1425s21c1
Sequence:CCGGGGGATGGCGCCTATCAGATTACTCGAGTAATCTGATAGGCGCCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172802.4-584s21c1
Sequence:CCGGATCCACCCACAGGCTCATTTGCTCGAGCAAATGAGCCTGTGGGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks