EMAIL THIS PAGE TO A FRIEND

FSCN3

fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)

56 Gene Product Result for
UniProtKB ID: Q9NQT6, A4D0Z2, A6NLL7, B2RA62
Gene ID:
Mouse(56223) fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)
Rat(296947) fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)
dog(475205) fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)
cow(511917) fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)
domestic cat(101098855) fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)
domestic guinea pig(100726411) fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)
naked mole-rat(101724586) fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)
sheep(101109697) fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)
Domestic Rabbit(100328638) fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019569 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019569 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019569 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020369 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020369 Rosetta Predictions human pricing
NM_001004232 Rosetta Predictions rat pricing
NM_019569 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110078 predicted 1081
2 SASI_Hs01_00110079 predicted 540
3 SASI_Hs01_00110081 predicted 1376
4 SASI_Hs01_00110082 predicted 554
5 SASI_Hs02_00353322 predicted 1089
6 SASI_Hs01_00110084 predicted 536
7 SASI_Hs02_00353323 predicted 304
8 SASI_Hs01_00110085 predicted 1092
9 SASI_Hs01_00110086 predicted 372
10 SASI_Hs01_00110087 predicted 1602
11 SASI_Hs01_00110080 predicted 1569
12 SASI_Hs01_00110083 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004232 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032701 predicted 679
2 SASI_Rn01_00032702 predicted 461
3 SASI_Rn01_00032703 predicted 373
4 SASI_Rn01_00032704 predicted 622
5 SASI_Rn01_00032705 predicted 454
6 SASI_Rn01_00032706 predicted 966
7 SASI_Rn01_00032707 predicted 338
8 SASI_Rn01_00032708 predicted 670
9 SASI_Rn01_00032709 predicted 793
10 SASI_Rn02_00198235 predicted 423
11 SASI_Rn01_00032710 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062015 predicted 702
2 SASI_Mm01_00062016 predicted 1341
3 SASI_Mm01_00062018 predicted 685
4 SASI_Mm01_00062019 predicted 437
5 SASI_Mm02_00324623 predicted 195
6 SASI_Mm01_00062020 predicted 477
7 SASI_Mm01_00062021 predicted 1521
8 SASI_Mm01_00062022 predicted 1554
9 SASI_Mm01_00062023 predicted 1206
10 SASI_Mm01_00062024 predicted 199
11 SASI_Mm01_00062017 predicted 641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019569
FSCN3 MISSION shRNA Bacterial Glycerol Stock
fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019569.2-1202s21c1
Sequence:CCGGGATGGCCTGCTAATGGCAAATCTCGAGATTTGCCATTAGCAGGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019569.2-295s21c1
Sequence:CCGGACAGGCTGTGATACGACTAAACTCGAGTTTAGTCGTATCACAGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019569.2-1354s21c1
Sequence:CCGGACCTGACTGTATTCAGCTATTCTCGAGAATAGCTGAATACAGTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019569.2-1648s1c1
Sequence:CCGGCCAGGAACAACCTCTGAACTACTCGAGTAGTTCAGAGGTTGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019569.2-1420s1c1
Sequence:CCGGCTTCTGGTCAATAACATCCTTCTCGAGAAGGATGTTATTGACCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019569.2-347s1c1
Sequence:CCGGGCAGATGGTACTGTGTGCTATCTCGAGATAGCACACAGTACCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019569.2-196s1c1
Sequence:CCGGCCTCACCTTTGAAGCATATAACTCGAGTTATATGCTTCAAAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019569.2-1587s1c1
Sequence:CCGGCCAAAGAATGTATCTGGGAATCTCGAGATTCCCAGATACATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019569
FSCN3 MISSION shRNA shRNA Plasmid DNA
fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019569.2-1202s21c1
Sequence:CCGGGATGGCCTGCTAATGGCAAATCTCGAGATTTGCCATTAGCAGGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019569.2-295s21c1
Sequence:CCGGACAGGCTGTGATACGACTAAACTCGAGTTTAGTCGTATCACAGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019569.2-1354s21c1
Sequence:CCGGACCTGACTGTATTCAGCTATTCTCGAGAATAGCTGAATACAGTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019569.2-1648s1c1
Sequence:CCGGCCAGGAACAACCTCTGAACTACTCGAGTAGTTCAGAGGTTGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019569.2-1420s1c1
Sequence:CCGGCTTCTGGTCAATAACATCCTTCTCGAGAAGGATGTTATTGACCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019569.2-347s1c1
Sequence:CCGGGCAGATGGTACTGTGTGCTATCTCGAGATAGCACACAGTACCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019569.2-196s1c1
Sequence:CCGGCCTCACCTTTGAAGCATATAACTCGAGTTATATGCTTCAAAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019569.2-1587s1c1
Sequence:CCGGCCAAAGAATGTATCTGGGAATCTCGAGATTCCCAGATACATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019569
FSCN3 MISSION shRNA Lentiviral Transduction Particles
fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019569.2-1202s21c1
Sequence:CCGGGATGGCCTGCTAATGGCAAATCTCGAGATTTGCCATTAGCAGGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019569.2-295s21c1
Sequence:CCGGACAGGCTGTGATACGACTAAACTCGAGTTTAGTCGTATCACAGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019569.2-1354s21c1
Sequence:CCGGACCTGACTGTATTCAGCTATTCTCGAGAATAGCTGAATACAGTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019569.2-1648s1c1
Sequence:CCGGCCAGGAACAACCTCTGAACTACTCGAGTAGTTCAGAGGTTGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019569.2-1420s1c1
Sequence:CCGGCTTCTGGTCAATAACATCCTTCTCGAGAAGGATGTTATTGACCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019569.2-347s1c1
Sequence:CCGGGCAGATGGTACTGTGTGCTATCTCGAGATAGCACACAGTACCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019569.2-196s1c1
Sequence:CCGGCCTCACCTTTGAAGCATATAACTCGAGTTATATGCTTCAAAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019569.2-1587s1c1
Sequence:CCGGCCAAAGAATGTATCTGGGAATCTCGAGATTCCCAGATACATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020369
FSCN3 MISSION shRNA Bacterial Glycerol Stock
fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020369.1-331s21c1
Sequence:CCGGACTGCAACTGCGAAGAGTTTGCTCGAGCAAACTCTTCGCAGTTGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020369.1-1518s21c1
Sequence:CCGGGGGATCCTTCTGGTCAATAACCTCGAGGTTATTGACCAGAAGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020369.1-1691s1c1
Sequence:CCGGCCAGAGAGTGTATCTGGGAATCTCGAGATTCCCAGATACACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020369.1-805s1c1
Sequence:CCGGCACCACTTCTTGTCCCATGTACTCGAGTACATGGGACAAGAAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020369.1-1575s1c1
Sequence:CCGGCCTCAACTTCTGTATCGAGCTCTCGAGAGCTCGATACAGAAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020369.1-546s1c1
Sequence:CCGGCCTAATCTCTGGTCGTTATTTCTCGAGAAATAACGACCAGAGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020369.1-917s1c1
Sequence:CCGGGCATGTTATATCCACAGGGCACTCGAGTGCCCTGTGGATATAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020369.1-1038s1c1
Sequence:CCGGGCGGTTCATCTCAGTCATCTACTCGAGTAGATGACTGAGATGAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020369.1-1719s1c1
Sequence:CCGGCAATGGGATGTCACCTACCAACTCGAGTTGGTAGGTGACATCCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020369
FSCN3 MISSION shRNA shRNA Plasmid DNA
fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020369.1-331s21c1
Sequence:CCGGACTGCAACTGCGAAGAGTTTGCTCGAGCAAACTCTTCGCAGTTGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020369.1-1518s21c1
Sequence:CCGGGGGATCCTTCTGGTCAATAACCTCGAGGTTATTGACCAGAAGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020369.1-1691s1c1
Sequence:CCGGCCAGAGAGTGTATCTGGGAATCTCGAGATTCCCAGATACACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020369.1-805s1c1
Sequence:CCGGCACCACTTCTTGTCCCATGTACTCGAGTACATGGGACAAGAAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020369.1-1575s1c1
Sequence:CCGGCCTCAACTTCTGTATCGAGCTCTCGAGAGCTCGATACAGAAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020369.1-546s1c1
Sequence:CCGGCCTAATCTCTGGTCGTTATTTCTCGAGAAATAACGACCAGAGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020369.1-917s1c1
Sequence:CCGGGCATGTTATATCCACAGGGCACTCGAGTGCCCTGTGGATATAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020369.1-1038s1c1
Sequence:CCGGGCGGTTCATCTCAGTCATCTACTCGAGTAGATGACTGAGATGAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020369.1-1719s1c1
Sequence:CCGGCAATGGGATGTCACCTACCAACTCGAGTTGGTAGGTGACATCCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020369
FSCN3 MISSION shRNA Lentiviral Transduction Particles
fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020369.1-331s21c1
Sequence:CCGGACTGCAACTGCGAAGAGTTTGCTCGAGCAAACTCTTCGCAGTTGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020369.1-1518s21c1
Sequence:CCGGGGGATCCTTCTGGTCAATAACCTCGAGGTTATTGACCAGAAGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020369.1-1691s1c1
Sequence:CCGGCCAGAGAGTGTATCTGGGAATCTCGAGATTCCCAGATACACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020369.1-805s1c1
Sequence:CCGGCACCACTTCTTGTCCCATGTACTCGAGTACATGGGACAAGAAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020369.1-1575s1c1
Sequence:CCGGCCTCAACTTCTGTATCGAGCTCTCGAGAGCTCGATACAGAAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020369.1-546s1c1
Sequence:CCGGCCTAATCTCTGGTCGTTATTTCTCGAGAAATAACGACCAGAGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020369.1-917s1c1
Sequence:CCGGGCATGTTATATCCACAGGGCACTCGAGTGCCCTGTGGATATAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020369.1-1038s1c1
Sequence:CCGGGCGGTTCATCTCAGTCATCTACTCGAGTAGATGACTGAGATGAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020369.1-1719s1c1
Sequence:CCGGCAATGGGATGTCACCTACCAACTCGAGTTGGTAGGTGACATCCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks