EMAIL THIS PAGE TO A FRIEND

FSD1

fibronectin type III and SPRY domain containing 1

55 Gene Product Result for
Synonyms: GLFND MIR1
UniProtKB ID: Q9BTV5, B2RDT0, Q9BXN0, Q9HAG4
Gene ID:
Human(79187) Summary: This gene encodes a centrosome associated protein that is characterized by an N-terminal coiled-coil region downstream of B-box (BBC) domain, a central fibronectin type III domain, and a C-terminal repeats in splA and RyR (SPRY) domain. The encoded protein associates with a subset of microtubules and may be involved in the stability and organization of microtubules during cytokinesis. [provided by RefSeq, Apr 2009]
Mouse(240121) fibronectin type 3 and SPRY domain-containing protein
Rat(301506) fibronectin type III and SPRY domain containing 1
Zebrafish(566722) fibronectin type III and SPRY domain containing 1
Thale Cress(828613) superoxide dismutase [Fe]
domestic cat(101090335) fibronectin type III and SPRY domain containing 1
cow(510595) fibronectin type III and SPRY domain containing 1
Horse(100062912) fibronectin type III and SPRY domain containing 1
dog(476743) fibronectin type III and SPRY domain containing 1
sheep(101112564) fibronectin type III and SPRY domain containing 1
naked mole-rat(101702395) fibronectin type III and SPRY domain containing 1
domestic guinea pig(100728087) fibronectin type III and SPRY domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024333 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024333 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024333 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024333 Rosetta Predictions human pricing
NM_001106918 Rosetta Predictions rat pricing
NM_183178 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049444 predicted 741
2 SASI_Hs01_00049445 predicted 1054
3 SASI_Hs01_00049446 predicted 751
4 SASI_Hs01_00049447 predicted 436
5 SASI_Hs01_00049448 predicted 1269
6 SASI_Hs01_00049449 predicted 497
7 SASI_Hs01_00049450 predicted 615
8 SASI_Hs01_00049451 predicted 512
9 SASI_Hs01_00049453 predicted 467
10 SASI_Hs02_00356687 predicted 785
11 SASI_Hs01_00049452 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106918 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223686 predicted 465
2 SASI_Rn02_00223687 predicted 397
3 SASI_Rn02_00223688 predicted 523
4 SASI_Rn02_00223689 predicted 264
5 SASI_Rn02_00223690 predicted 397
6 SASI_Rn02_00223691 predicted 258
7 SASI_Rn02_00223692 predicted 266
8 SASI_Rn02_00223693 predicted 458
9 SASI_Rn02_00223694 predicted 347
10 SASI_Rn02_00223695 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114341 predicted 217
2 SASI_Mm01_00114342 predicted 539
3 SASI_Mm01_00114343 predicted 210
4 SASI_Mm01_00114344 predicted 820
5 SASI_Mm01_00114345 predicted 1134
6 SASI_Mm01_00114346 predicted 1414
7 SASI_Mm02_00350286 predicted 511
8 SASI_Mm01_00114348 predicted 669
9 SASI_Mm01_00114349 predicted 859
10 SASI_Mm01_00114350 predicted 1015
11 SASI_Mm01_00114347 predicted 1301
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024333
FSD1 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III and SPRY domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024333.1-770s1c1
Sequence:CCGGGAAATACATGAACTTCCGTGTCTCGAGACACGGAAGTTCATGTATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024333.1-240s1c1
Sequence:CCGGGAAGGCATGCTTATGAAGATACTCGAGTATCTTCATAAGCATGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024333.1-1372s1c1
Sequence:CCGGCCAAACAAGTGCTGCACACTTCTCGAGAAGTGTGCAGCACTTGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024333.1-137s1c1
Sequence:CCGGCCTGAAACAGATGCTGCTGAACTCGAGTTCAGCAGCATCTGTTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024333.1-399s1c1
Sequence:CCGGGCTGCCAAGCAAATCAAAGATCTCGAGATCTTTGATTTGCTTGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024333.2-840s21c1
Sequence:CCGGGTACACCCTGACAGGTCTCAACTCGAGTTGAGACCTGTCAGGGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024333.2-1325s21c1
Sequence:CCGGGGTGCCTGCACGTCAACAATTCTCGAGAATTGTTGACGTGCAGGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024333
FSD1 MISSION shRNA shRNA Plasmid DNA
fibronectin type III and SPRY domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024333.1-770s1c1
Sequence:CCGGGAAATACATGAACTTCCGTGTCTCGAGACACGGAAGTTCATGTATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024333.1-240s1c1
Sequence:CCGGGAAGGCATGCTTATGAAGATACTCGAGTATCTTCATAAGCATGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024333.1-1372s1c1
Sequence:CCGGCCAAACAAGTGCTGCACACTTCTCGAGAAGTGTGCAGCACTTGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024333.1-137s1c1
Sequence:CCGGCCTGAAACAGATGCTGCTGAACTCGAGTTCAGCAGCATCTGTTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024333.1-399s1c1
Sequence:CCGGGCTGCCAAGCAAATCAAAGATCTCGAGATCTTTGATTTGCTTGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024333.2-840s21c1
Sequence:CCGGGTACACCCTGACAGGTCTCAACTCGAGTTGAGACCTGTCAGGGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024333.2-1325s21c1
Sequence:CCGGGGTGCCTGCACGTCAACAATTCTCGAGAATTGTTGACGTGCAGGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024333
FSD1 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III and SPRY domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024333.1-770s1c1
Sequence:CCGGGAAATACATGAACTTCCGTGTCTCGAGACACGGAAGTTCATGTATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024333.1-240s1c1
Sequence:CCGGGAAGGCATGCTTATGAAGATACTCGAGTATCTTCATAAGCATGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024333.1-1372s1c1
Sequence:CCGGCCAAACAAGTGCTGCACACTTCTCGAGAAGTGTGCAGCACTTGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024333.1-137s1c1
Sequence:CCGGCCTGAAACAGATGCTGCTGAACTCGAGTTCAGCAGCATCTGTTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024333.1-399s1c1
Sequence:CCGGGCTGCCAAGCAAATCAAAGATCTCGAGATCTTTGATTTGCTTGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024333.2-840s21c1
Sequence:CCGGGTACACCCTGACAGGTCTCAACTCGAGTTGAGACCTGTCAGGGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024333.2-1325s21c1
Sequence:CCGGGGTGCCTGCACGTCAACAATTCTCGAGAATTGTTGACGTGCAGGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183178
FSD1 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III and SPRY domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183178.1-1621s1c1
Sequence:CCGGCCAGGCCATCTACCAGCTGGGCTCGAGCCCAGCTGGTAGATGGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183178.1-702s1c1
Sequence:CCGGGACAGCAAGATCGACCACTATCTCGAGATAGTGGTCGATCTTGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183178.1-947s1c1
Sequence:CCGGCGGGTCCACATCTCACCAGAACTCGAGTTCTGGTGAGATGTGGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183178.1-545s1c1
Sequence:CCGGCGACAATATGAGTCACCTCATCTCGAGATGAGGTGACTCATATTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183178.1-474s1c1
Sequence:CCGGGCCGCCAAGGAAATCAAAGATCTCGAGATCTTTGATTTCCTTGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183178.2-728s21c1
Sequence:CCGGGGAGTACCGCAAGACCAATTTCTCGAGAAATTGGTCTTGCGGTACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183178.2-1585s21c1
Sequence:CCGGGTGCCACTAGCAGTTCCAATACTCGAGTATTGGAACTGCTAGTGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183178.2-514s21c1
Sequence:CCGGCCTTCCGACTATCGCTCAAAGCTCGAGCTTTGAGCGATAGTCGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183178
FSD1 MISSION shRNA shRNA Plasmid DNA
fibronectin type III and SPRY domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183178.1-1621s1c1
Sequence:CCGGCCAGGCCATCTACCAGCTGGGCTCGAGCCCAGCTGGTAGATGGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183178.1-702s1c1
Sequence:CCGGGACAGCAAGATCGACCACTATCTCGAGATAGTGGTCGATCTTGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183178.1-947s1c1
Sequence:CCGGCGGGTCCACATCTCACCAGAACTCGAGTTCTGGTGAGATGTGGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183178.1-545s1c1
Sequence:CCGGCGACAATATGAGTCACCTCATCTCGAGATGAGGTGACTCATATTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183178.1-474s1c1
Sequence:CCGGGCCGCCAAGGAAATCAAAGATCTCGAGATCTTTGATTTCCTTGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183178.2-728s21c1
Sequence:CCGGGGAGTACCGCAAGACCAATTTCTCGAGAAATTGGTCTTGCGGTACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183178.2-1585s21c1
Sequence:CCGGGTGCCACTAGCAGTTCCAATACTCGAGTATTGGAACTGCTAGTGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183178.2-514s21c1
Sequence:CCGGCCTTCCGACTATCGCTCAAAGCTCGAGCTTTGAGCGATAGTCGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183178
FSD1 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III and SPRY domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183178.1-1621s1c1
Sequence:CCGGCCAGGCCATCTACCAGCTGGGCTCGAGCCCAGCTGGTAGATGGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183178.1-702s1c1
Sequence:CCGGGACAGCAAGATCGACCACTATCTCGAGATAGTGGTCGATCTTGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183178.1-947s1c1
Sequence:CCGGCGGGTCCACATCTCACCAGAACTCGAGTTCTGGTGAGATGTGGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183178.1-545s1c1
Sequence:CCGGCGACAATATGAGTCACCTCATCTCGAGATGAGGTGACTCATATTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183178.1-474s1c1
Sequence:CCGGGCCGCCAAGGAAATCAAAGATCTCGAGATCTTTGATTTCCTTGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183178.2-728s21c1
Sequence:CCGGGGAGTACCGCAAGACCAATTTCTCGAGAAATTGGTCTTGCGGTACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183178.2-1585s21c1
Sequence:CCGGGTGCCACTAGCAGTTCCAATACTCGAGTATTGGAACTGCTAGTGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183178.2-514s21c1
Sequence:CCGGCCTTCCGACTATCGCTCAAAGCTCGAGCTTTGAGCGATAGTCGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)