EMAIL THIS PAGE TO A FRIEND

FSD1L

fibronectin type III and SPRY domain containing 1-like

156 Gene Product Result for
Synonyms: CCDC10 CSDUFD1 FSD1CL FSD1NL MIR1
Gene ID:
Mouse(319636) fibronectin type III and SPRY domain containing 1-like
Rat(313208) fibronectin type III and SPRY domain containing 1-like
domestic guinea pig(100721890) fibronectin type III and SPRY domain containing 1-like
naked mole-rat(101702529) fibronectin type III and SPRY domain containing 1-like
sheep(101118501) fibronectin type III and SPRY domain containing 1-like
Domestic Rabbit(100358312) fibronectin type III and SPRY domain containing 1-like
Zebrafish(100004668) fibronectin type III and SPRY domain containing 1-like
chicken(427302) fibronectin type III and SPRY domain containing 1-like
dog(474793) fibronectin type III and SPRY domain containing 1-like
cow(510535) fibronectin type III and SPRY domain containing 1-like
Horse(100060499) fibronectin type III and SPRY domain containing 1-like
domestic cat(101084399) fibronectin type III and SPRY domain containing 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176966 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176966 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176966 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207647 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031919 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005911 MISSION® esiRNA esiRNA targeting human FSD1L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031919 Rosetta Predictions human pricing
NM_207647 Rosetta Predictions human pricing
XR_007574 Rosetta Predictions rat pricing
NM_176966 Rosetta Predictions mouse pricing
XM_001052088 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145913 predicted 290
2 SASI_Hs01_00145914 predicted 248
3 SASI_Hs01_00145915 predicted 237
4 SASI_Hs01_00145917 predicted 205
5 SASI_Hs01_00145918 predicted 201
6 SASI_Hs01_00145919 predicted 292
7 SASI_Hs01_00145920 predicted 293
8 SASI_Hs01_00145921 predicted 240
9 SASI_Hs01_00145922 predicted 205
10 SASI_Hs02_00359051 predicted 249
11 SASI_Hs01_00145916 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159723 predicted 290
2 SASI_Hs01_00159724 predicted 257
3 SASI_Hs01_00159725 predicted 243
4 SASI_Hs01_00159727 predicted 202
5 SASI_Hs01_00159728 predicted 205
6 SASI_Hs01_00159729 predicted 294
7 SASI_Hs01_00159730 predicted 294
8 SASI_Hs01_00159731 predicted 240
9 SASI_Hs01_00159732 predicted 204
10 SASI_Hs02_00374175 predicted 244
11 SASI_Hs01_00159726 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007574 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147774 predicted 700
2 SASI_Rn01_00147775 predicted 1240
3 SASI_Rn02_00414945 predicted 884
4 SASI_Rn01_00147776 predicted 738
5 SASI_Rn02_00414946 predicted 1289
6 SASI_Rn01_00147778 predicted 919
7 SASI_Rn02_00414947 predicted 1000
8 SASI_Rn01_00147779 predicted 772
9 SASI_Rn01_00147780 predicted 1028
10 SASI_Rn01_00147781 predicted 1307
11 SASI_Rn01_00147777 predicted 1173
12 SASI_Rn01_00147782 predicted 590
13 SASI_Rn01_00147783 predicted 1254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176966 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346872 predicted 766
2 SASI_Mm02_00346873 predicted 842
3 SASI_Mm02_00346874 predicted 195
4 SASI_Mm02_00346875 predicted 70
5 SASI_Mm02_00346876 predicted 421
6 SASI_Mm02_00346877 predicted 341
7 SASI_Mm02_00346878 predicted 323
8 SASI_Mm02_00346879 predicted 324
9 SASI_Mm02_00346880 predicted 192
10 SASI_Mm02_00346881 predicted 132
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052088 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247348 predicted 819
2 SASI_Mm01_00247349 predicted 899
3 SASI_Mm01_00247350 predicted 256
4 SASI_Mm01_00247351 predicted 129
5 SASI_Mm01_00247352 predicted 485
6 SASI_Mm01_00247353 predicted 400
7 SASI_Mm01_00247354 predicted 376
8 SASI_Mm01_00247355 predicted 379
9 SASI_Mm01_00247356 predicted 191
10 SASI_Mm01_00247357 predicted 244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176966
FSD1L MISSION shRNA Bacterial Glycerol Stock
fibronectin type III and SPRY domain containing 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176966.3-196s21c1
Sequence:CCGGTGATAGCTTGTACTCTATATTCTCGAGAATATAGAGTACAAGCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176966.3-867s21c1
Sequence:CCGGTCCTTAAGTTGGGCTAATATACTCGAGTATATTAGCCCAACTTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176966.3-345s21c1
Sequence:CCGGCAACAAGGTCATTAGATATTACTCGAGTAATATCTAATGACCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176966.3-112s21c1
Sequence:CCGGGAACTTCATTGATACACTAAACTCGAGTTTAGTGTATCAATGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176966.3-75s21c1
Sequence:CCGGTCATTTCAACTCTGGCAAATACTCGAGTATTTGCCAGAGTTGAAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176966
FSD1L MISSION shRNA shRNA Plasmid DNA
fibronectin type III and SPRY domain containing 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176966.3-196s21c1
Sequence:CCGGTGATAGCTTGTACTCTATATTCTCGAGAATATAGAGTACAAGCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176966.3-867s21c1
Sequence:CCGGTCCTTAAGTTGGGCTAATATACTCGAGTATATTAGCCCAACTTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176966.3-345s21c1
Sequence:CCGGCAACAAGGTCATTAGATATTACTCGAGTAATATCTAATGACCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176966.3-112s21c1
Sequence:CCGGGAACTTCATTGATACACTAAACTCGAGTTTAGTGTATCAATGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176966.3-75s21c1
Sequence:CCGGTCATTTCAACTCTGGCAAATACTCGAGTATTTGCCAGAGTTGAAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176966
FSD1L MISSION shRNA Lentiviral Transduction Particles
fibronectin type III and SPRY domain containing 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176966.3-196s21c1
Sequence:CCGGTGATAGCTTGTACTCTATATTCTCGAGAATATAGAGTACAAGCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176966.3-867s21c1
Sequence:CCGGTCCTTAAGTTGGGCTAATATACTCGAGTATATTAGCCCAACTTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176966.3-345s21c1
Sequence:CCGGCAACAAGGTCATTAGATATTACTCGAGTAATATCTAATGACCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176966.3-112s21c1
Sequence:CCGGGAACTTCATTGATACACTAAACTCGAGTTTAGTGTATCAATGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176966.3-75s21c1
Sequence:CCGGTCATTTCAACTCTGGCAAATACTCGAGTATTTGCCAGAGTTGAAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207647
FSD1L MISSION shRNA Bacterial Glycerol Stock
fibronectin type III and SPRY domain containing 1-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207647.1-796s1c1
Sequence:CCGGCCATGTCAACAACTGGCTACACTCGAGTGTAGCCAGTTGTTGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207647.1-1040s1c1
Sequence:CCGGCCAAGTGCTGTGAGAACACTTCTCGAGAAGTGTTCTCACAGCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207647.1-976s1c1
Sequence:CCGGGCCAGTACTACCTGGTTTCATCTCGAGATGAAACCAGGTAGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207647.1-1150s1c1
Sequence:CCGGCGTCTTGATTAGGTGGCCTTTCTCGAGAAAGGCCACCTAATCAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207647.1-1479s1c1
Sequence:CCGGGCCTTCTTTCTTCTGTACTTTCTCGAGAAAGTACAGAAGAAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207647.1-775s1c1
Sequence:CCGGGACAAACACTAGTTGGTGTATCTCGAGATACACCAACTAGTGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207647.1-3477s1c1
Sequence:CCGGGCGTTCTTAAAGGTCTCTAAACTCGAGTTTAGAGACCTTTAAGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207647.1-1176s1c1
Sequence:CCGGGCAGTTACTAATCACAGGAATCTCGAGATTCCTGTGATTAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207647.1-665s1c1
Sequence:CCGGGCTATTGAAAGTGGACAACATCTCGAGATGTTGTCCACTTTCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207647
FSD1L MISSION shRNA shRNA Plasmid DNA
fibronectin type III and SPRY domain containing 1-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207647.1-796s1c1
Sequence:CCGGCCATGTCAACAACTGGCTACACTCGAGTGTAGCCAGTTGTTGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207647.1-1040s1c1
Sequence:CCGGCCAAGTGCTGTGAGAACACTTCTCGAGAAGTGTTCTCACAGCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207647.1-976s1c1
Sequence:CCGGGCCAGTACTACCTGGTTTCATCTCGAGATGAAACCAGGTAGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207647.1-1150s1c1
Sequence:CCGGCGTCTTGATTAGGTGGCCTTTCTCGAGAAAGGCCACCTAATCAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207647.1-1479s1c1
Sequence:CCGGGCCTTCTTTCTTCTGTACTTTCTCGAGAAAGTACAGAAGAAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207647.1-775s1c1
Sequence:CCGGGACAAACACTAGTTGGTGTATCTCGAGATACACCAACTAGTGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207647.1-3477s1c1
Sequence:CCGGGCGTTCTTAAAGGTCTCTAAACTCGAGTTTAGAGACCTTTAAGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207647.1-1176s1c1
Sequence:CCGGGCAGTTACTAATCACAGGAATCTCGAGATTCCTGTGATTAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207647.1-665s1c1
Sequence:CCGGGCTATTGAAAGTGGACAACATCTCGAGATGTTGTCCACTTTCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207647
FSD1L MISSION shRNA Lentiviral Transduction Particles
fibronectin type III and SPRY domain containing 1-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207647.1-796s1c1
Sequence:CCGGCCATGTCAACAACTGGCTACACTCGAGTGTAGCCAGTTGTTGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207647.1-1040s1c1
Sequence:CCGGCCAAGTGCTGTGAGAACACTTCTCGAGAAGTGTTCTCACAGCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207647.1-976s1c1
Sequence:CCGGGCCAGTACTACCTGGTTTCATCTCGAGATGAAACCAGGTAGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207647.1-1150s1c1
Sequence:CCGGCGTCTTGATTAGGTGGCCTTTCTCGAGAAAGGCCACCTAATCAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207647.1-1479s1c1
Sequence:CCGGGCCTTCTTTCTTCTGTACTTTCTCGAGAAAGTACAGAAGAAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207647.1-775s1c1
Sequence:CCGGGACAAACACTAGTTGGTGTATCTCGAGATACACCAACTAGTGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207647.1-3477s1c1
Sequence:CCGGGCGTTCTTAAAGGTCTCTAAACTCGAGTTTAGAGACCTTTAAGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207647.1-1176s1c1
Sequence:CCGGGCAGTTACTAATCACAGGAATCTCGAGATTCCTGTGATTAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207647.1-665s1c1
Sequence:CCGGGCTATTGAAAGTGGACAACATCTCGAGATGTTGTCCACTTTCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031919
FSD1L MISSION shRNA Bacterial Glycerol Stock
fibronectin type III and SPRY domain containing 1-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031919.1-169s1c1
Sequence:CCGGCGTCCAACATACTCTCAGAGTCTCGAGACTCTGAGAGTATGTTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031919.1-80s1c1
Sequence:CCGGGATCATTTCAACTCTGGCAAACTCGAGTTTGCCAGAGTTGAAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031919.1-285s1c1
Sequence:CCGGGAGTTACAGAGTCAGATTAGTCTCGAGACTAATCTGACTCTGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031919.1-245s1c1
Sequence:CCGGGATTAACTGTATCAAGCAGGACTCGAGTCCTGCTTGATACAGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031919.1-176s1c1
Sequence:CCGGCATACTCTCAGAGTTAGATGACTCGAGTCATCTAACTCTGAGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031919.1-170s1c1
Sequence:CCGGGTCCAACATACTCTCAGAGTTCTCGAGAACTCTGAGAGTATGTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031919.1-264s1c1
Sequence:CCGGGAACAAGCTCGTAAATCCCAACTCGAGTTGGGATTTACGAGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031919.1-320s1c1
Sequence:CCGGCCTGGAGAACTCTGAAGAACTCTCGAGAGTTCTTCAGAGTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031919
FSD1L MISSION shRNA shRNA Plasmid DNA
fibronectin type III and SPRY domain containing 1-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031919.1-169s1c1
Sequence:CCGGCGTCCAACATACTCTCAGAGTCTCGAGACTCTGAGAGTATGTTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031919.1-80s1c1
Sequence:CCGGGATCATTTCAACTCTGGCAAACTCGAGTTTGCCAGAGTTGAAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031919.1-285s1c1
Sequence:CCGGGAGTTACAGAGTCAGATTAGTCTCGAGACTAATCTGACTCTGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031919.1-245s1c1
Sequence:CCGGGATTAACTGTATCAAGCAGGACTCGAGTCCTGCTTGATACAGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031919.1-176s1c1
Sequence:CCGGCATACTCTCAGAGTTAGATGACTCGAGTCATCTAACTCTGAGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031919.1-170s1c1
Sequence:CCGGGTCCAACATACTCTCAGAGTTCTCGAGAACTCTGAGAGTATGTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031919.1-264s1c1
Sequence:CCGGGAACAAGCTCGTAAATCCCAACTCGAGTTGGGATTTACGAGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031919.1-320s1c1
Sequence:CCGGCCTGGAGAACTCTGAAGAACTCTCGAGAGTTCTTCAGAGTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031919
FSD1L MISSION shRNA Lentiviral Transduction Particles
fibronectin type III and SPRY domain containing 1-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031919.1-169s1c1
Sequence:CCGGCGTCCAACATACTCTCAGAGTCTCGAGACTCTGAGAGTATGTTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031919.1-80s1c1
Sequence:CCGGGATCATTTCAACTCTGGCAAACTCGAGTTTGCCAGAGTTGAAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031919.1-285s1c1
Sequence:CCGGGAGTTACAGAGTCAGATTAGTCTCGAGACTAATCTGACTCTGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031919.1-245s1c1
Sequence:CCGGGATTAACTGTATCAAGCAGGACTCGAGTCCTGCTTGATACAGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031919.1-176s1c1
Sequence:CCGGCATACTCTCAGAGTTAGATGACTCGAGTCATCTAACTCTGAGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031919.1-170s1c1
Sequence:CCGGGTCCAACATACTCTCAGAGTTCTCGAGAACTCTGAGAGTATGTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031919.1-264s1c1
Sequence:CCGGGAACAAGCTCGTAAATCCCAACTCGAGTTGGGATTTACGAGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031919.1-320s1c1
Sequence:CCGGCCTGGAGAACTCTGAAGAACTCTCGAGAGTTCTTCAGAGTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks