EMAIL THIS PAGE TO A FRIEND

FSD2

fibronectin type III and SPRY domain containing 2

78 Gene Product Result for
Synonyms: SPRYD1
UniProtKB ID: A1L4K1, B3KVG1
Gene ID:
Mouse(244091) fibronectin type III and SPRY domain containing 2
Rat(308779) fibronectin type III and SPRY domain containing 2
Thale Cress(835183) Fe superoxide dismutase 2
chicken(427503) fibronectin type III and SPRY domain containing 2
cow(540530) fibronectin type III and SPRY domain containing 2
Horse(100068362) fibronectin type III and SPRY domain containing 2
domestic cat(101089443) fibronectin type III and SPRY domain containing 2
dog(609716) fibronectin type III and SPRY domain containing 2
sheep(101110540) fibronectin type III and SPRY domain containing 2
naked mole-rat(101702772) fibronectin type III and SPRY domain containing 2
domestic guinea pig(100730664) fibronectin type III and SPRY domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172904 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172904 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172904 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001007122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007122 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007122 Rosetta Predictions human pricing
XM_001062337 Rosetta Predictions rat pricing
XM_218860 Rosetta Predictions rat pricing
NM_172904 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193358 predicted 1850
2 SASI_Hs01_00193359 predicted 1477
3 SASI_Hs01_00193360 predicted 1346
4 SASI_Hs01_00193361 predicted 2078
5 SASI_Hs01_00193362 predicted 1906
6 SASI_Hs01_00193363 predicted 1426
7 SASI_Hs01_00193364 predicted 1553
8 SASI_Hs01_00193365 predicted 459
9 SASI_Hs01_00193366 predicted 637
10 SASI_Hs02_00305229 predicted 387
11 SASI_Hs01_00193367 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303136 predicted 1303
2 SASI_Rn02_00303137 predicted 1726
3 SASI_Rn02_00303138 predicted 215
4 SASI_Rn02_00303139 predicted 1596
5 SASI_Rn02_00303140 predicted 1271
6 SASI_Rn02_00303141 predicted 1987
7 SASI_Rn02_00303142 predicted 1966
8 SASI_Rn02_00303143 predicted 1747
9 SASI_Rn02_00303144 predicted 1447
10 SASI_Rn02_00303145 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218860 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378152 predicted 1006
2 SASI_Rn02_00378153 predicted 1270
3 SASI_Rn02_00378154 predicted 1296
4 SASI_Rn02_00378155 predicted 221
5 SASI_Rn02_00378156 predicted 1357
6 SASI_Rn02_00378157 predicted 608
7 SASI_Rn02_00378158 predicted 1204
8 SASI_Rn02_00378159 predicted 1249
9 SASI_Rn02_00378160 predicted 539
10 SASI_Rn02_00378161 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161436 predicted 711
2 SASI_Mm01_00161437 predicted 2277
3 SASI_Mm01_00161439 predicted 1251
4 SASI_Mm01_00161440 predicted 837
5 SASI_Mm01_00161441 predicted 862
6 SASI_Mm01_00161442 predicted 554
7 SASI_Mm01_00161443 predicted 1627
8 SASI_Mm01_00161444 predicted 1298
9 SASI_Mm01_00161445 predicted 1399
10 SASI_Mm02_00344892 predicted 1825
11 SASI_Mm01_00161438 predicted 1336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172904
FSD2 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III and SPRY domain containing 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172904.1-1935s1c1
Sequence:CCGGGCTGAGCATTTGGACTACACTCTCGAGAGTGTAGTCCAAATGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172904.1-2261s1c1
Sequence:CCGGCAATGGCATTTCAATGCCAAACTCGAGTTTGGCATTGAAATGCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172904.2-1255s21c1
Sequence:CCGGCGTGTATGCTGGAGCTTATATCTCGAGATATAAGCTCCAGCATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172904.2-2330s21c1
Sequence:CCGGTTTAGGCCCTTCTGGTATTTCCTCGAGGAAATACCAGAAGGGCCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172904.2-1255s1c1
Sequence:CCGGCGTGTATGCTGGAGCTTATATCTCGAGATATAAGCTCCAGCATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172904.2-334s21c1
Sequence:CCGGGCCGAAGATGACCGTGAATTACTCGAGTAATTCACGGTCATCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172904.2-1880s21c1
Sequence:CCGGCGCCGAGCAAGACGCAATTTACTCGAGTAAATTGCGTCTTGCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172904.2-2784s21c1
Sequence:CCGGTTCCCGTAGGCTCACATATTTCTCGAGAAATATGTGAGCCTACGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172904
FSD2 MISSION shRNA shRNA Plasmid DNA
fibronectin type III and SPRY domain containing 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172904.1-1935s1c1
Sequence:CCGGGCTGAGCATTTGGACTACACTCTCGAGAGTGTAGTCCAAATGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172904.1-2261s1c1
Sequence:CCGGCAATGGCATTTCAATGCCAAACTCGAGTTTGGCATTGAAATGCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172904.2-1255s21c1
Sequence:CCGGCGTGTATGCTGGAGCTTATATCTCGAGATATAAGCTCCAGCATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172904.2-2330s21c1
Sequence:CCGGTTTAGGCCCTTCTGGTATTTCCTCGAGGAAATACCAGAAGGGCCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172904.2-1255s1c1
Sequence:CCGGCGTGTATGCTGGAGCTTATATCTCGAGATATAAGCTCCAGCATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172904.2-334s21c1
Sequence:CCGGGCCGAAGATGACCGTGAATTACTCGAGTAATTCACGGTCATCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172904.2-1880s21c1
Sequence:CCGGCGCCGAGCAAGACGCAATTTACTCGAGTAAATTGCGTCTTGCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172904.2-2784s21c1
Sequence:CCGGTTCCCGTAGGCTCACATATTTCTCGAGAAATATGTGAGCCTACGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172904
FSD2 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III and SPRY domain containing 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172904.1-1935s1c1
Sequence:CCGGGCTGAGCATTTGGACTACACTCTCGAGAGTGTAGTCCAAATGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172904.1-2261s1c1
Sequence:CCGGCAATGGCATTTCAATGCCAAACTCGAGTTTGGCATTGAAATGCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172904.2-1255s21c1
Sequence:CCGGCGTGTATGCTGGAGCTTATATCTCGAGATATAAGCTCCAGCATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172904.2-2330s21c1
Sequence:CCGGTTTAGGCCCTTCTGGTATTTCCTCGAGGAAATACCAGAAGGGCCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172904.2-1255s1c1
Sequence:CCGGCGTGTATGCTGGAGCTTATATCTCGAGATATAAGCTCCAGCATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172904.2-334s21c1
Sequence:CCGGGCCGAAGATGACCGTGAATTACTCGAGTAATTCACGGTCATCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172904.2-1880s21c1
Sequence:CCGGCGCCGAGCAAGACGCAATTTACTCGAGTAAATTGCGTCTTGCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172904.2-2784s21c1
Sequence:CCGGTTCCCGTAGGCTCACATATTTCTCGAGAAATATGTGAGCCTACGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007122
FSD2 MISSION shRNA Bacterial Glycerol Stock
fibronectin type III and SPRY domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007122.1-2106s1c1
Sequence:CCGGGATGTCCGTAAACAGGAGGATCTCGAGATCCTCCTGTTTACGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137536    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007122.1-2521s1c1
Sequence:CCGGCCATGTGCCCAGCACAATTTACTCGAGTAAATTGTGCTGGGCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007122.1-2235s1c1
Sequence:CCGGCCACCAAAGAAGATTGGCATTCTCGAGAATGCCAATCTTCTTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007122.1-721s1c1
Sequence:CCGGGTGTCACTTGTAAGACTCCAACTCGAGTTGGAGTCTTACAAGTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007122.1-816s1c1
Sequence:CCGGGCCAAGGATGAAATTCACAAACTCGAGTTTGTGAATTTCATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007122.1-1084s1c1
Sequence:CCGGCTTGCAAAGAACTGATGGAAACTCGAGTTTCCATCAGTTCTTTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007122.1-1097s1c1
Sequence:CCGGGATGGAAACAATAGAGGAGATCTCGAGATCTCCTCTATTGTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007122.1-393s1c1
Sequence:CCGGGTGGATGAACTTGTCCACTTACTCGAGTAAGTGGACAAGTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007122.1-1915s1c1
Sequence:CCGGCCATTTCTGAAGACGGACTTACTCGAGTAAGTCCGTCTTCAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007122
FSD2 MISSION shRNA shRNA Plasmid DNA
fibronectin type III and SPRY domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007122.1-2106s1c1
Sequence:CCGGGATGTCCGTAAACAGGAGGATCTCGAGATCCTCCTGTTTACGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137536    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007122.1-2521s1c1
Sequence:CCGGCCATGTGCCCAGCACAATTTACTCGAGTAAATTGTGCTGGGCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007122.1-2235s1c1
Sequence:CCGGCCACCAAAGAAGATTGGCATTCTCGAGAATGCCAATCTTCTTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007122.1-721s1c1
Sequence:CCGGGTGTCACTTGTAAGACTCCAACTCGAGTTGGAGTCTTACAAGTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007122.1-816s1c1
Sequence:CCGGGCCAAGGATGAAATTCACAAACTCGAGTTTGTGAATTTCATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007122.1-1084s1c1
Sequence:CCGGCTTGCAAAGAACTGATGGAAACTCGAGTTTCCATCAGTTCTTTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007122.1-1097s1c1
Sequence:CCGGGATGGAAACAATAGAGGAGATCTCGAGATCTCCTCTATTGTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007122.1-393s1c1
Sequence:CCGGGTGGATGAACTTGTCCACTTACTCGAGTAAGTGGACAAGTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007122.1-1915s1c1
Sequence:CCGGCCATTTCTGAAGACGGACTTACTCGAGTAAGTCCGTCTTCAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007122
FSD2 MISSION shRNA Lentiviral Transduction Particles
fibronectin type III and SPRY domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007122.1-2106s1c1
Sequence:CCGGGATGTCCGTAAACAGGAGGATCTCGAGATCCTCCTGTTTACGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137536    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007122.1-2521s1c1
Sequence:CCGGCCATGTGCCCAGCACAATTTACTCGAGTAAATTGTGCTGGGCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007122.1-2235s1c1
Sequence:CCGGCCACCAAAGAAGATTGGCATTCTCGAGAATGCCAATCTTCTTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007122.1-721s1c1
Sequence:CCGGGTGTCACTTGTAAGACTCCAACTCGAGTTGGAGTCTTACAAGTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007122.1-816s1c1
Sequence:CCGGGCCAAGGATGAAATTCACAAACTCGAGTTTGTGAATTTCATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007122.1-1084s1c1
Sequence:CCGGCTTGCAAAGAACTGATGGAAACTCGAGTTTCCATCAGTTCTTTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007122.1-1097s1c1
Sequence:CCGGGATGGAAACAATAGAGGAGATCTCGAGATCTCCTCTATTGTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007122.1-393s1c1
Sequence:CCGGGTGGATGAACTTGTCCACTTACTCGAGTAAGTGGACAAGTTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007122.1-1915s1c1
Sequence:CCGGCCATTTCTGAAGACGGACTTACTCGAGTAAGTCCGTCTTCAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks