EMAIL THIS PAGE TO A FRIEND

FSHB

follicle stimulating hormone, beta polypeptide

125 Gene Product Result for
UniProtKB ID: P01225, A2TF08, A5JVV3, Q14D61
Gene ID:
Human(2488) Summary: The pituitary glycoprotein hormone family includes follicle-stimulating hormone, luteinizing hormone, chorionic gonadotropin, and thyroid-stimulating hormone. All of these glycoproteins consist of an identical alpha subunit and a hormone-specific beta subunit. This gene encodes the beta subunit of follicle-stimulating hormone. In conjunction with luteinizing hormone, follicle-stimulating hormone induces egg and sperm production. Alternative splicing results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(14308) follicle stimulating hormone beta
Rat(25447) follicle stimulating hormone, beta polypeptide
Zebrafish(402919) follicle stimulating hormone, beta polypeptide
cow(281171) follicle stimulating hormone, beta polypeptide
Horse(100033829) follicle stimulating hormone, beta polypeptide
dog(485428) follicle stimulating hormone, beta polypeptide
chicken(374108) follicle stimulating hormone, beta polypeptide
domestic guinea pig(100135522) follicle stimulating hormone beta
naked mole-rat(101717666) follicle stimulating hormone, beta polypeptide
sheep(443387) follicle stimulating hormone, beta polypeptide
Domestic Rabbit(100008946) follicle stimulating hormone, beta polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008045 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008045 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008045 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000510 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000510 Rosetta Predictions human pricing
NM_001018080 Rosetta Predictions human pricing
NM_001007597 Rosetta Predictions rat pricing
XM_575192 Rosetta Predictions rat pricing
NM_008045 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169543 predicted 595
2 SASI_Hs01_00169544 predicted 453
3 SASI_Hs01_00169545 predicted 426
4 SASI_Hs01_00169546 predicted 430
5 SASI_Hs01_00169547 predicted 484
6 SASI_Hs01_00169549 predicted 456
7 SASI_Hs01_00169550 predicted 394
8 SASI_Hs01_00169551 predicted 465
9 SASI_Hs01_00169552 predicted 319
10 SASI_Hs02_00302695 predicted 373
11 SASI_Hs01_00169548 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306984 predicted 569
2 SASI_Hs02_00306985 predicted 419
3 SASI_Hs02_00306986 predicted 391
4 SASI_Hs02_00306987 predicted 395
5 SASI_Hs02_00306988 predicted 463
6 SASI_Hs02_00306989 predicted 431
7 SASI_Hs01_00187763 predicted 360
8 SASI_Hs01_00187764 predicted 434
9 SASI_Hs02_00306990 predicted 285
10 SASI_Hs02_00306991 predicted 342
11 SASI_Hs01_00187756 predicted 446
12 SASI_Hs01_00187757 predicted 621
13 SASI_Hs01_00187758 predicted 611
14 SASI_Hs01_00187759 predicted 615
15 SASI_Hs01_00187760 predicted 678
16 SASI_Hs01_00187761 predicted 905
17 SASI_Hs01_00187762 predicted 640
18 SASI_Hs01_00187765 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074507 predicted 355
2 SASI_Rn02_00198668 predicted 187
3 SASI_Rn02_00198669 predicted 361
4 SASI_Rn01_00074509 predicted 259
5 SASI_Rn02_00198670 predicted 280
6 SASI_Rn01_00074510 predicted 307
7 SASI_Rn01_00074511 predicted 224
8 SASI_Rn01_00074513 predicted 100
9 SASI_Rn01_00074514 predicted 176
10 SASI_Rn02_00198671 predicted 354
11 SASI_Rn01_00074506 predicted 300
12 SASI_Rn01_00074508 predicted 217
13 SASI_Rn01_00074512 predicted 303
14 SASI_Rn01_00074515 predicted 166
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575192 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00141762 predicted 621
2 SASI_Rn01_00141763 predicted 571
3 SASI_Rn01_00141764 predicted 675
4 SASI_Rn01_00141765 predicted 564
5 SASI_Rn01_00141766 predicted 633
6 SASI_Rn01_00141767 predicted 680
7 SASI_Rn01_00141768 predicted 568
8 SASI_Rn01_00141769 predicted 551
9 SASI_Rn01_00141770 predicted 586
10 SASI_Rn01_00141771 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313008 predicted 357
2 SASI_Mm01_00185622 predicted 653
3 SASI_Mm01_00185623 predicted 895
4 SASI_Mm01_00185624 predicted 679
5 SASI_Mm01_00185625 predicted 255
6 SASI_Mm01_00185626 predicted 272
7 SASI_Mm01_00185627 predicted 802
8 SASI_Mm01_00185629 predicted 250
9 SASI_Mm01_00185630 predicted 283
10 SASI_Mm01_00185631 predicted 335
11 SASI_Mm01_00185628 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008045
FSHB MISSION shRNA Bacterial Glycerol Stock
follicle stimulating hormone, beta polypeptide
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008045.2-328s21c1
Sequence:CCGGCAGACTCCCTCTACACATATCCTCGAGGATATGTGTAGAGGGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008045.2-883s21c1
Sequence:CCGGATTGCAAACTTAAGGCCTAAACTCGAGTTTAGGCCTTAAGTTTGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008045.2-1433s1c1
Sequence:CCGGCGCCTATCTATGTTCTCCTAACTCGAGTTAGGAGAACATAGATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008045.2-270s1c1
Sequence:CCGGTGTACCTTCAAGGAGCTGGTACTCGAGTACCAGCTCCTTGAAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008045.2-356s1c1
Sequence:CCGGCACTGAATGTCACTGTGGCAACTCGAGTTGCCACAGTGACATTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008045.2-119s1c1
Sequence:CCGGCCATAGCTGTGAATTGACCAACTCGAGTTGGTCAATTCACAGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008045.2-171s1c1
Sequence:CCGGCGTTTCTGCATAAGCATCAATCTCGAGATTGATGCTTATGCAGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008045
FSHB MISSION shRNA shRNA Plasmid DNA
follicle stimulating hormone, beta polypeptide
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008045.2-328s21c1
Sequence:CCGGCAGACTCCCTCTACACATATCCTCGAGGATATGTGTAGAGGGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008045.2-883s21c1
Sequence:CCGGATTGCAAACTTAAGGCCTAAACTCGAGTTTAGGCCTTAAGTTTGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008045.2-1433s1c1
Sequence:CCGGCGCCTATCTATGTTCTCCTAACTCGAGTTAGGAGAACATAGATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008045.2-270s1c1
Sequence:CCGGTGTACCTTCAAGGAGCTGGTACTCGAGTACCAGCTCCTTGAAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008045.2-356s1c1
Sequence:CCGGCACTGAATGTCACTGTGGCAACTCGAGTTGCCACAGTGACATTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008045.2-119s1c1
Sequence:CCGGCCATAGCTGTGAATTGACCAACTCGAGTTGGTCAATTCACAGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008045.2-171s1c1
Sequence:CCGGCGTTTCTGCATAAGCATCAATCTCGAGATTGATGCTTATGCAGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008045
FSHB MISSION shRNA Lentiviral Transduction Particles
follicle stimulating hormone, beta polypeptide
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008045.2-328s21c1
Sequence:CCGGCAGACTCCCTCTACACATATCCTCGAGGATATGTGTAGAGGGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008045.2-883s21c1
Sequence:CCGGATTGCAAACTTAAGGCCTAAACTCGAGTTTAGGCCTTAAGTTTGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008045.2-1433s1c1
Sequence:CCGGCGCCTATCTATGTTCTCCTAACTCGAGTTAGGAGAACATAGATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008045.2-270s1c1
Sequence:CCGGTGTACCTTCAAGGAGCTGGTACTCGAGTACCAGCTCCTTGAAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008045.2-356s1c1
Sequence:CCGGCACTGAATGTCACTGTGGCAACTCGAGTTGCCACAGTGACATTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008045.2-119s1c1
Sequence:CCGGCCATAGCTGTGAATTGACCAACTCGAGTTGGTCAATTCACAGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008045.2-171s1c1
Sequence:CCGGCGTTTCTGCATAAGCATCAATCTCGAGATTGATGCTTATGCAGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000510
FSHB MISSION shRNA Bacterial Glycerol Stock
follicle stimulating hormone, beta polypeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000510.2-146s21c1
Sequence:CCGGTCACCATTGCAATAGAGAAAGCTCGAGCTTTCTCTATTGCAATGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000510.2-798s21c1
Sequence:CCGGAGTAATGGGAGTGAGTGAAAGCTCGAGCTTTCACTCACTCCCATTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000510.2-667s21c1
Sequence:CCGGGGTCTGATTTCATAAGGTTTACTCGAGTAAACCTTATGAAATCAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000510.2-456s21c1
Sequence:CCGGATAAAGATCAGTGGACATTTCCTCGAGGAAATGTCCACTGATCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000510.1-54s1c1
Sequence:CCGGCAATAGCTGTGAGCTGACCAACTCGAGTTGGTCAGCTCACAGCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000510.1-152s1c1
Sequence:CCGGACACCAGGGATCTGGTGTATACTCGAGTATACACCAGATCCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000510.1-113s1c1
Sequence:CCGGGCATAAGCATCAACACCACTTCTCGAGAAGTGGTGTTGATGCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000510.1-212s1c1
Sequence:CCGGTCAAGGAACTGGTATATGAAACTCGAGTTTCATATACCAGTTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000510.1-37s1c1
Sequence:CCGGTGGAAAGCAATCTGCTGCAATCTCGAGATTGCAGCAGATTGCTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000510
FSHB MISSION shRNA shRNA Plasmid DNA
follicle stimulating hormone, beta polypeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000510.2-146s21c1
Sequence:CCGGTCACCATTGCAATAGAGAAAGCTCGAGCTTTCTCTATTGCAATGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000510.2-798s21c1
Sequence:CCGGAGTAATGGGAGTGAGTGAAAGCTCGAGCTTTCACTCACTCCCATTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000510.2-667s21c1
Sequence:CCGGGGTCTGATTTCATAAGGTTTACTCGAGTAAACCTTATGAAATCAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000510.2-456s21c1
Sequence:CCGGATAAAGATCAGTGGACATTTCCTCGAGGAAATGTCCACTGATCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000510.1-54s1c1
Sequence:CCGGCAATAGCTGTGAGCTGACCAACTCGAGTTGGTCAGCTCACAGCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000510.1-152s1c1
Sequence:CCGGACACCAGGGATCTGGTGTATACTCGAGTATACACCAGATCCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000510.1-113s1c1
Sequence:CCGGGCATAAGCATCAACACCACTTCTCGAGAAGTGGTGTTGATGCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000510.1-212s1c1
Sequence:CCGGTCAAGGAACTGGTATATGAAACTCGAGTTTCATATACCAGTTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000510.1-37s1c1
Sequence:CCGGTGGAAAGCAATCTGCTGCAATCTCGAGATTGCAGCAGATTGCTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000510
FSHB MISSION shRNA Lentiviral Transduction Particles
follicle stimulating hormone, beta polypeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000510.2-146s21c1
Sequence:CCGGTCACCATTGCAATAGAGAAAGCTCGAGCTTTCTCTATTGCAATGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000510.2-798s21c1
Sequence:CCGGAGTAATGGGAGTGAGTGAAAGCTCGAGCTTTCACTCACTCCCATTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000510.2-667s21c1
Sequence:CCGGGGTCTGATTTCATAAGGTTTACTCGAGTAAACCTTATGAAATCAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000510.2-456s21c1
Sequence:CCGGATAAAGATCAGTGGACATTTCCTCGAGGAAATGTCCACTGATCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000510.1-54s1c1
Sequence:CCGGCAATAGCTGTGAGCTGACCAACTCGAGTTGGTCAGCTCACAGCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000510.1-152s1c1
Sequence:CCGGACACCAGGGATCTGGTGTATACTCGAGTATACACCAGATCCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000510.1-113s1c1
Sequence:CCGGGCATAAGCATCAACACCACTTCTCGAGAAGTGGTGTTGATGCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000510.1-212s1c1
Sequence:CCGGTCAAGGAACTGGTATATGAAACTCGAGTTTCATATACCAGTTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000510.1-37s1c1
Sequence:CCGGTGGAAAGCAATCTGCTGCAATCTCGAGATTGCAGCAGATTGCTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks