EMAIL THIS PAGE TO A FRIEND

FSHR

follicle stimulating hormone receptor

Synonyms: FSHRO LGR1 ODG1
Gene ID:
Human(2492) Summary: The protein encoded by this gene belongs to family 1 of G-protein coupled receptors. It is the receptor for follicle stimulating hormone and functions in gonad development. Mutations in this gene cause ovarian dysgenesis type 1, and also ovarian hyperstimulation syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Mouse(14309) follicle stimulating hormone receptor
Rat(25449) follicle stimulating hormone receptor
Zebrafish(195820) follicle stimulating hormone receptor
chicken(395962) follicle stimulating hormone receptor
cow(281172) follicle stimulating hormone receptor
Horse(100052957) follicle stimulating hormone receptor
domestic cat(554348) follicle stimulating hormone receptor
dog(481367) follicle stimulating hormone receptor
Goat(100861291) follicle stimulating hormone receptor
sheep(443299) follicle stimulating hormone receptor
naked mole-rat(101719312) follicle stimulating hormone receptor
domestic guinea pig(100135523) follicle stimulating hormone receptor
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000145 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013523 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013523 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013523 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000145 Rosetta Predictions human pricing
NM_181446 Rosetta Predictions human pricing
NM_199237 Rosetta Predictions rat pricing
NM_013523 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121931 predicted 1284
2 SASI_Hs02_00301960 predicted 1895
3 SASI_Hs01_00121932 predicted 1973
4 SASI_Hs01_00121933 predicted 321
5 SASI_Hs01_00121934 predicted 2004
6 SASI_Hs01_00121935 predicted 487
7 SASI_Hs01_00121936 predicted 1209
8 SASI_Hs01_00121937 predicted 1456
9 SASI_Hs01_00121938 predicted 2115
10 SASI_Hs01_00121939 predicted 477
11 SASI_Hs01_00121940 predicted 1630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222937 predicted 1100
2 SASI_Hs02_00370058 predicted 1709
3 SASI_Hs01_00222938 predicted 1787
4 SASI_Hs01_00222939 predicted 324
5 SASI_Hs01_00222940 predicted 1816
6 SASI_Hs01_00222941 predicted 483
7 SASI_Hs01_00222942 predicted 1018
8 SASI_Hs01_00222943 predicted 1271
9 SASI_Hs01_00222944 predicted 1927
10 SASI_Hs01_00222945 predicted 482
11 SASI_Hs01_00222946 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055080 predicted 1299
2 SASI_Rn02_00270157 predicted 930
3 SASI_Rn01_00055081 predicted 1285
4 SASI_Rn01_00055082 predicted 654
5 SASI_Rn01_00055083 predicted 1765
6 SASI_Rn01_00055084 predicted 1948
7 SASI_Rn01_00055085 predicted 1484
8 SASI_Rn01_00055086 predicted 829
9 SASI_Rn01_00055087 predicted 646
10 SASI_Rn02_00270158 predicted 516
11 SASI_Rn01_00055078 predicted 509
12 SASI_Rn01_00055079 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073681 predicted 656
2 SASI_Mm01_00073682 predicted 1077
3 SASI_Mm02_00322214 predicted 422
4 SASI_Mm01_00073683 predicted 1760
5 SASI_Mm01_00073684 predicted 925
6 SASI_Mm01_00073685 predicted 1309
7 SASI_Mm01_00073686 predicted 1299
8 SASI_Mm01_00073687 predicted 1270
9 SASI_Mm01_00073688 predicted 936
10 SASI_Mm01_00073689 predicted 638
11 SASI_Mm01_00073690 predicted 1944
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000145
FSHR MISSION shRNA Bacterial Glycerol Stock
follicle stimulating hormone receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000145.x-174s1c1
Sequence:CCGGGAGAGCAAGGTGACAGAGATTCTCGAGAATCTCTGTCACCTTGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000145.x-651s1c1
Sequence:CCGGACCCAACTAGATGAGCTGAATCTCGAGATTCAGCTCATCTAGTTGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000145.x-1074s1c1
Sequence:CCGGGACTATGACTTATGCAATGAACTCGAGTTCATTGCATAAGTCATAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000145.x-1232s1c1
Sequence:CCGGCCTAACTACCAGCCAATATAACTCGAGTTATATTGGCTGGTAGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000145.x-2320s1c1
Sequence:CCGGGTGATACATTAGGAAGCTGAACTCGAGTTCAGCTTCCTAATGTATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000145.2-937s21c1
Sequence:CCGGTTCATCCAATTTGCAACAAATCTCGAGATTTGTTGCAAATTGGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000145.2-664s21c1
Sequence:CCGGAGCTGAATCTAAGCGATAATACTCGAGTATTATCGCTTAGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000145.2-453s21c1
Sequence:CCGGATATCCAACACAGGTATTAAGCTCGAGCTTAATACCTGTGTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000145
FSHR MISSION shRNA shRNA Plasmid DNA
follicle stimulating hormone receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000145.x-174s1c1
Sequence:CCGGGAGAGCAAGGTGACAGAGATTCTCGAGAATCTCTGTCACCTTGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000145.x-651s1c1
Sequence:CCGGACCCAACTAGATGAGCTGAATCTCGAGATTCAGCTCATCTAGTTGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000145.x-1074s1c1
Sequence:CCGGGACTATGACTTATGCAATGAACTCGAGTTCATTGCATAAGTCATAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000145.x-1232s1c1
Sequence:CCGGCCTAACTACCAGCCAATATAACTCGAGTTATATTGGCTGGTAGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000145.x-2320s1c1
Sequence:CCGGGTGATACATTAGGAAGCTGAACTCGAGTTCAGCTTCCTAATGTATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000145.2-937s21c1
Sequence:CCGGTTCATCCAATTTGCAACAAATCTCGAGATTTGTTGCAAATTGGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000145.2-664s21c1
Sequence:CCGGAGCTGAATCTAAGCGATAATACTCGAGTATTATCGCTTAGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000145.2-453s21c1
Sequence:CCGGATATCCAACACAGGTATTAAGCTCGAGCTTAATACCTGTGTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000145
FSHR MISSION shRNA Lentiviral Transduction Particles
follicle stimulating hormone receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000145.x-174s1c1
Sequence:CCGGGAGAGCAAGGTGACAGAGATTCTCGAGAATCTCTGTCACCTTGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000145.x-651s1c1
Sequence:CCGGACCCAACTAGATGAGCTGAATCTCGAGATTCAGCTCATCTAGTTGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000145.x-1074s1c1
Sequence:CCGGGACTATGACTTATGCAATGAACTCGAGTTCATTGCATAAGTCATAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000145.x-1232s1c1
Sequence:CCGGCCTAACTACCAGCCAATATAACTCGAGTTATATTGGCTGGTAGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000145.x-2320s1c1
Sequence:CCGGGTGATACATTAGGAAGCTGAACTCGAGTTCAGCTTCCTAATGTATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000145.2-937s21c1
Sequence:CCGGTTCATCCAATTTGCAACAAATCTCGAGATTTGTTGCAAATTGGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000145.2-664s21c1
Sequence:CCGGAGCTGAATCTAAGCGATAATACTCGAGTATTATCGCTTAGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000145.2-453s21c1
Sequence:CCGGATATCCAACACAGGTATTAAGCTCGAGCTTAATACCTGTGTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013523
FSHR MISSION shRNA Bacterial Glycerol Stock
follicle stimulating hormone receptor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013523.2-2011s1c1
Sequence:CCGGGCCCAGATTTACAAGACAGAACTCGAGTTCTGTCTTGTAAATCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013523.2-945s1c1
Sequence:CCGGGTCTATTTCAAGGCAAGATATCTCGAGATATCTTGCCTTGAAATAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013523.2-342s1c1
Sequence:CCGGCCTACCCAACTTGCATGAAATCTCGAGATTTCATGCAAGTTGGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013523.2-1452s1c1
Sequence:CCGGCCTAGAAAGATGGCATACCATCTCGAGATGGTATGCCATCTTTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013523.2-801s1c1
Sequence:CCGGCAGGTCAACATACCGCTTGAACTCGAGTTCAAGCGGTATGTTGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013523.3-442s21c1
Sequence:CCGGATATCCAACACAGGCATTAAACTCGAGTTTAATGCCTGTGTTGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013523.3-2103s21c1
Sequence:CCGGTTACGTGCTTGTCCCTCTAAACTCGAGTTTAGAGGGACAAGCACGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013523.3-1294s21c1
Sequence:CCGGGGGATCTACTTGCTACTTATACTCGAGTATAAGTAGCAAGTAGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013523.3-302s21c1
Sequence:CCGGATGATGTCTTGGAGGTAATAGCTCGAGCTATTACCTCCAAGACATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013523
FSHR MISSION shRNA shRNA Plasmid DNA
follicle stimulating hormone receptor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013523.2-2011s1c1
Sequence:CCGGGCCCAGATTTACAAGACAGAACTCGAGTTCTGTCTTGTAAATCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013523.2-945s1c1
Sequence:CCGGGTCTATTTCAAGGCAAGATATCTCGAGATATCTTGCCTTGAAATAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013523.2-342s1c1
Sequence:CCGGCCTACCCAACTTGCATGAAATCTCGAGATTTCATGCAAGTTGGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013523.2-1452s1c1
Sequence:CCGGCCTAGAAAGATGGCATACCATCTCGAGATGGTATGCCATCTTTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013523.2-801s1c1
Sequence:CCGGCAGGTCAACATACCGCTTGAACTCGAGTTCAAGCGGTATGTTGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013523.3-442s21c1
Sequence:CCGGATATCCAACACAGGCATTAAACTCGAGTTTAATGCCTGTGTTGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013523.3-2103s21c1
Sequence:CCGGTTACGTGCTTGTCCCTCTAAACTCGAGTTTAGAGGGACAAGCACGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013523.3-1294s21c1
Sequence:CCGGGGGATCTACTTGCTACTTATACTCGAGTATAAGTAGCAAGTAGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013523.3-302s21c1
Sequence:CCGGATGATGTCTTGGAGGTAATAGCTCGAGCTATTACCTCCAAGACATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013523
FSHR MISSION shRNA Lentiviral Transduction Particles
follicle stimulating hormone receptor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013523.2-2011s1c1
Sequence:CCGGGCCCAGATTTACAAGACAGAACTCGAGTTCTGTCTTGTAAATCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013523.2-945s1c1
Sequence:CCGGGTCTATTTCAAGGCAAGATATCTCGAGATATCTTGCCTTGAAATAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013523.2-342s1c1
Sequence:CCGGCCTACCCAACTTGCATGAAATCTCGAGATTTCATGCAAGTTGGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013523.2-1452s1c1
Sequence:CCGGCCTAGAAAGATGGCATACCATCTCGAGATGGTATGCCATCTTTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013523.2-801s1c1
Sequence:CCGGCAGGTCAACATACCGCTTGAACTCGAGTTCAAGCGGTATGTTGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013523.3-442s21c1
Sequence:CCGGATATCCAACACAGGCATTAAACTCGAGTTTAATGCCTGTGTTGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013523.3-2103s21c1
Sequence:CCGGTTACGTGCTTGTCCCTCTAAACTCGAGTTTAGAGGGACAAGCACGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013523.3-1294s21c1
Sequence:CCGGGGGATCTACTTGCTACTTATACTCGAGTATAAGTAGCAAGTAGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013523.3-302s21c1
Sequence:CCGGATGATGTCTTGGAGGTAATAGCTCGAGCTATTACCTCCAAGACATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks