EMAIL THIS PAGE TO A FRIEND

FSIP1

fibrous sheath interacting protein 1

59 Gene Product Result for
UniProtKB ID: Q8NA03, Q6X2C8, Q86Y89
Gene ID:
Mouse(71313) fibrous sheath-interacting protein 1
Rat(296074) fibrous sheath interacting protein 1
Zebrafish(550574) fibrous sheath interacting protein 1
dog(478256) fibrous sheath interacting protein 1
domestic cat(101088168) fibrous sheath interacting protein 1
cow(617063) fibrous sheath interacting protein 1
Horse(100071504) fibrous sheath interacting protein 1
chicken(423286) fibrous sheath interacting protein 1
domestic guinea pig(100728166) fibrous sheath interacting protein 1
naked mole-rat(101702611) fibrous sheath interacting protein 1
sheep(101106849) fibrous sheath interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152597 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152597 Rosetta Predictions human pricing
NM_001013078 Rosetta Predictions rat pricing
NM_027759 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027399 predicted 1695
2 SASI_Hs01_00027397 predicted 1908
3 SASI_Hs01_00027398 predicted 2043
4 SASI_Hs01_00027400 predicted 1785
5 SASI_Hs01_00027401 predicted 405
6 SASI_Hs01_00027402 predicted 1562
7 SASI_Hs01_00027403 predicted 900
8 SASI_Hs01_00027404 predicted 1899
9 SASI_Hs01_00027405 predicted 503
10 SASI_Hs02_00366441 predicted 1544
11 SASI_Hs01_00027396 predicted 1830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093939 predicted 623
2 SASI_Rn01_00093940 predicted 298
3 SASI_Rn01_00093941 predicted 1246
4 SASI_Rn01_00093942 predicted 949
5 SASI_Rn01_00093943 predicted 749
6 SASI_Rn01_00093944 predicted 903
7 SASI_Rn01_00093945 predicted 489
8 SASI_Rn01_00093946 predicted 1382
9 SASI_Rn01_00093947 predicted 759
10 SASI_Rn01_00093948 predicted 1433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034078 predicted 879
2 SASI_Mm01_00034079 predicted 271
3 SASI_Mm01_00034080 predicted 580
4 SASI_Mm01_00034081 predicted 1227
5 SASI_Mm01_00034082 predicted 295
6 SASI_Mm01_00034083 predicted 480
7 SASI_Mm01_00034084 predicted 772
8 SASI_Mm01_00034085 predicted 1283
9 SASI_Mm01_00034086 predicted 468
10 SASI_Mm01_00034087 predicted 1260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027759
FSIP1 MISSION shRNA Bacterial Glycerol Stock
fibrous sheath interacting protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027759.2-1219s21c1
Sequence:CCGGCAGAGCCATAAGGGTGATATGCTCGAGCATATCACCCTTATGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027759.2-1197s21c1
Sequence:CCGGCACCATCTTCAGCCTTGAAAGCTCGAGCTTTCAAGGCTGAAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027759.2-1148s21c1
Sequence:CCGGAGCTTGCTGAGATTGACATAACTCGAGTTATGTCAATCTCAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027759.2-1104s21c1
Sequence:CCGGGGTTCCAGGAGAAGGCTATACCTCGAGGTATAGCCTTCTCCTGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027759.2-227s21c1
Sequence:CCGGCTGGGAGCCGAAGTTCAAATGCTCGAGCATTTGAACTTCGGCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027759.1-961s1c1
Sequence:CCGGGCGAAACATTGAGTTGGCCAACTCGAGTTGGCCAACTCAATGTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027759.1-1197s1c1
Sequence:CCGGCCACCATCTTCAGCCTTGAAACTCGAGTTTCAAGGCTGAAGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027759.1-488s1c1
Sequence:CCGGGAGACGAATGCTGTACTTCAACTCGAGTTGAAGTACAGCATTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027759
FSIP1 MISSION shRNA shRNA Plasmid DNA
fibrous sheath interacting protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027759.2-1219s21c1
Sequence:CCGGCAGAGCCATAAGGGTGATATGCTCGAGCATATCACCCTTATGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027759.2-1197s21c1
Sequence:CCGGCACCATCTTCAGCCTTGAAAGCTCGAGCTTTCAAGGCTGAAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027759.2-1148s21c1
Sequence:CCGGAGCTTGCTGAGATTGACATAACTCGAGTTATGTCAATCTCAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027759.2-1104s21c1
Sequence:CCGGGGTTCCAGGAGAAGGCTATACCTCGAGGTATAGCCTTCTCCTGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027759.2-227s21c1
Sequence:CCGGCTGGGAGCCGAAGTTCAAATGCTCGAGCATTTGAACTTCGGCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027759.1-961s1c1
Sequence:CCGGGCGAAACATTGAGTTGGCCAACTCGAGTTGGCCAACTCAATGTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027759.1-1197s1c1
Sequence:CCGGCCACCATCTTCAGCCTTGAAACTCGAGTTTCAAGGCTGAAGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027759.1-488s1c1
Sequence:CCGGGAGACGAATGCTGTACTTCAACTCGAGTTGAAGTACAGCATTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027759
FSIP1 MISSION shRNA Lentiviral Transduction Particles
fibrous sheath interacting protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027759.2-1219s21c1
Sequence:CCGGCAGAGCCATAAGGGTGATATGCTCGAGCATATCACCCTTATGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027759.2-1197s21c1
Sequence:CCGGCACCATCTTCAGCCTTGAAAGCTCGAGCTTTCAAGGCTGAAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027759.2-1148s21c1
Sequence:CCGGAGCTTGCTGAGATTGACATAACTCGAGTTATGTCAATCTCAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027759.2-1104s21c1
Sequence:CCGGGGTTCCAGGAGAAGGCTATACCTCGAGGTATAGCCTTCTCCTGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027759.2-227s21c1
Sequence:CCGGCTGGGAGCCGAAGTTCAAATGCTCGAGCATTTGAACTTCGGCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027759.1-961s1c1
Sequence:CCGGGCGAAACATTGAGTTGGCCAACTCGAGTTGGCCAACTCAATGTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027759.1-1197s1c1
Sequence:CCGGCCACCATCTTCAGCCTTGAAACTCGAGTTTCAAGGCTGAAGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027759.1-488s1c1
Sequence:CCGGGAGACGAATGCTGTACTTCAACTCGAGTTGAAGTACAGCATTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152597
FSIP1 MISSION shRNA Bacterial Glycerol Stock
fibrous sheath interacting protein 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152597.4-1946s21c1
Sequence:CCGGAGAATGTAAAGAACCCTAATCCTCGAGGATTAGGGTTCTTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152597.4-1915s21c1
Sequence:CCGGCAGATGAGCAGGAGACTAAAGCTCGAGCTTTAGTCTCCTGCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152597.4-809s21c1
Sequence:CCGGCTCAGTGTTTCATACTCAAATCTCGAGATTTGAGTATGAAACACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152597.4-2090s21c1
Sequence:CCGGGTCGCTCTTTGTGGATTATATCTCGAGATATAATCCACAAAGAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152597.4-852s21c1
Sequence:CCGGCAGATGCAGAAACTCAATAAACTCGAGTTTATTGAGTTTCTGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152597.3-346s1c1
Sequence:CCGGGCAAGCAACTTGAACTCTGGTCTCGAGACCAGAGTTCAAGTTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152597
FSIP1 MISSION shRNA shRNA Plasmid DNA
fibrous sheath interacting protein 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152597.4-1946s21c1
Sequence:CCGGAGAATGTAAAGAACCCTAATCCTCGAGGATTAGGGTTCTTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152597.4-1915s21c1
Sequence:CCGGCAGATGAGCAGGAGACTAAAGCTCGAGCTTTAGTCTCCTGCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152597.4-809s21c1
Sequence:CCGGCTCAGTGTTTCATACTCAAATCTCGAGATTTGAGTATGAAACACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152597.4-2090s21c1
Sequence:CCGGGTCGCTCTTTGTGGATTATATCTCGAGATATAATCCACAAAGAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152597.4-852s21c1
Sequence:CCGGCAGATGCAGAAACTCAATAAACTCGAGTTTATTGAGTTTCTGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152597.3-346s1c1
Sequence:CCGGGCAAGCAACTTGAACTCTGGTCTCGAGACCAGAGTTCAAGTTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152597
FSIP1 MISSION shRNA Lentiviral Transduction Particles
fibrous sheath interacting protein 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152597.4-1946s21c1
Sequence:CCGGAGAATGTAAAGAACCCTAATCCTCGAGGATTAGGGTTCTTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152597.4-1915s21c1
Sequence:CCGGCAGATGAGCAGGAGACTAAAGCTCGAGCTTTAGTCTCCTGCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152597.4-809s21c1
Sequence:CCGGCTCAGTGTTTCATACTCAAATCTCGAGATTTGAGTATGAAACACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152597.4-2090s21c1
Sequence:CCGGGTCGCTCTTTGTGGATTATATCTCGAGATATAATCCACAAAGAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152597.4-852s21c1
Sequence:CCGGCAGATGCAGAAACTCAATAAACTCGAGTTTATTGAGTTTCTGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152597.3-346s1c1
Sequence:CCGGGCAAGCAACTTGAACTCTGGTCTCGAGACCAGAGTTCAAGTTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks