EMAIL THIS PAGE TO A FRIEND

FSIP2

fibrous sheath interacting protein 2

Gene ID:
Mouse(241516) fibrous sheath-interacting protein 2
Rat(680315) fibrous sheath-interacting protein 2
domestic guinea pig(100729134) fibrous sheath interacting protein 2
cow(539740) fibrous sheath interacting protein 2
cow(100140733) fibrous sheath interacting protein 2
Horse(100058522) fibrous sheath interacting protein 2
dog(611005) fibrous sheath interacting protein 2
domestic cat(101097826) fibrous sheath interacting protein 2
dog(611014) fibrous sheath interacting protein 2
147 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207482 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207482 Rosetta Predictions human pricing
XM_001056606 Rosetta Predictions rat pricing
XM_141020 Rosetta Predictions mouse pricing
XM_913669 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151075 predicted 2114
2 SASI_Hs02_00374112 predicted 574
3 SASI_Hs01_00151076 predicted 3097
4 SASI_Hs01_00151077 predicted 3445
5 SASI_Hs02_00374113 predicted 788
6 SASI_Hs01_00151079 predicted 2459
7 SASI_Hs02_00374114 predicted 2053
8 SASI_Hs01_00151082 predicted 2199
9 SASI_Hs02_00374115 predicted 4671
10 SASI_Hs01_00151084 predicted 2012
11 SASI_Hs01_00151078 predicted 1512
12 SASI_Hs01_00151080 predicted 1682
13 SASI_Hs01_00151081 predicted 344
14 SASI_Hs01_00151083 predicted 2766
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283766 predicted 459
2 SASI_Rn02_00283767 predicted 416
3 SASI_Rn02_00283768 predicted 611
4 SASI_Rn02_00283769 predicted 414
5 SASI_Rn02_00283770 predicted 299
6 SASI_Rn02_00283771 predicted 359
7 SASI_Rn02_00283772 predicted 797
8 SASI_Rn02_00283773 predicted 318
9 SASI_Rn02_00283774 predicted 763
10 SASI_Rn02_00283775 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_141020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217485 predicted 5184
2 SASI_Mm01_00217486 predicted 16218
3 SASI_Mm01_00217488 predicted 11025
4 SASI_Mm01_00217489 predicted 11394
5 SASI_Mm02_00425002 predicted 18990
6 SASI_Mm02_00425003 predicted 14894
7 SASI_Mm01_00217491 predicted 827
8 SASI_Mm02_00425004 predicted 15873
9 SASI_Mm01_00217492 predicted 15075
10 SASI_Mm02_00425005 predicted 13191
11 SASI_Mm01_00217487 predicted 355
12 SASI_Mm01_00217490 predicted 14793
13 SASI_Mm01_00217493 predicted 10701
14 SASI_Mm01_00217494 predicted 5300
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_913669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437927 predicted 5187
2 SASI_Mm02_00437928 predicted 16215
3 SASI_Mm02_00437929 predicted 11023
4 SASI_Mm02_00437930 predicted 10733
5 SASI_Mm02_00437931 predicted 11391
6 SASI_Mm02_00437932 predicted 18986
7 SASI_Mm02_00437933 predicted 14897
8 SASI_Mm02_00437934 predicted 824
9 SASI_Mm02_00437935 predicted 15874
10 SASI_Mm02_00437936 predicted 15071
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207482
FSIP2 MISSION shRNA Bacterial Glycerol Stock
fibrous sheath interacting protein 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207482.1-2559s1c1
Sequence:CCGGGTTGGCCTTGTTCTTGGCTAACTCGAGTTAGCCAAGAACAAGGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207482.1-971s1c1
Sequence:CCGGCCAAACTCTATGACACTGCTACTCGAGTAGCAGTGTCATAGAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207482.1-396s1c1
Sequence:CCGGCTCCTTGAAGTCCAAGAGAAACTCGAGTTTCTCTTGGACTTCAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207482.1-1487s1c1
Sequence:CCGGCCAGCAAAGAATGTCAAACTTCTCGAGAAGTTTGACATTCTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207482.1-4003s1c1
Sequence:CCGGGCATGGAAACAGTGTTAAGTTCTCGAGAACTTAACACTGTTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207482.1-608s1c1
Sequence:CCGGCGAAACTCAGTTATGACCAAACTCGAGTTTGGTCATAACTGAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207482.1-2796s1c1
Sequence:CCGGGCAACAATCAGGAACCAACAACTCGAGTTGTTGGTTCCTGATTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207482
FSIP2 MISSION shRNA shRNA Plasmid DNA
fibrous sheath interacting protein 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207482.1-2559s1c1
Sequence:CCGGGTTGGCCTTGTTCTTGGCTAACTCGAGTTAGCCAAGAACAAGGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207482.1-971s1c1
Sequence:CCGGCCAAACTCTATGACACTGCTACTCGAGTAGCAGTGTCATAGAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207482.1-396s1c1
Sequence:CCGGCTCCTTGAAGTCCAAGAGAAACTCGAGTTTCTCTTGGACTTCAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207482.1-1487s1c1
Sequence:CCGGCCAGCAAAGAATGTCAAACTTCTCGAGAAGTTTGACATTCTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207482.1-4003s1c1
Sequence:CCGGGCATGGAAACAGTGTTAAGTTCTCGAGAACTTAACACTGTTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207482.1-608s1c1
Sequence:CCGGCGAAACTCAGTTATGACCAAACTCGAGTTTGGTCATAACTGAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207482.1-2796s1c1
Sequence:CCGGGCAACAATCAGGAACCAACAACTCGAGTTGTTGGTTCCTGATTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207482
FSIP2 MISSION shRNA Lentiviral Transduction Particles
fibrous sheath interacting protein 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207482.1-2559s1c1
Sequence:CCGGGTTGGCCTTGTTCTTGGCTAACTCGAGTTAGCCAAGAACAAGGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207482.1-971s1c1
Sequence:CCGGCCAAACTCTATGACACTGCTACTCGAGTAGCAGTGTCATAGAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207482.1-396s1c1
Sequence:CCGGCTCCTTGAAGTCCAAGAGAAACTCGAGTTTCTCTTGGACTTCAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207482.1-1487s1c1
Sequence:CCGGCCAGCAAAGAATGTCAAACTTCTCGAGAAGTTTGACATTCTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207482.1-4003s1c1
Sequence:CCGGGCATGGAAACAGTGTTAAGTTCTCGAGAACTTAACACTGTTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207482.1-608s1c1
Sequence:CCGGCGAAACTCAGTTATGACCAAACTCGAGTTTGGTCATAACTGAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207482.1-2796s1c1
Sequence:CCGGGCAACAATCAGGAACCAACAACTCGAGTTGTTGGTTCCTGATTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks