EMAIL THIS PAGE TO A FRIEND

FST

follistatin

96 Gene Product Result for
Synonyms: FS
UniProtKB ID: P19883, B5BU94, Q9BTH0
Gene ID:
Human(10468) Summary: Follistatin is a single-chain gonadal protein that specifically inhibits follicle-stimulating hormone release. The single FST gene encodes two isoforms, FST317 and FST344 containing 317 and 344 amino acids respectively, resulting from alternative splicing of the precursor mRNA. In a study in which 37 candidate genes were tested for linkage and association with polycystic ovary syndrome (PCOS) or hyperandrogenemia in 150 families, evidence was found for linkage between PCOS and follistatin. [provided by RefSeq, Jul 2008]
Mouse(14313) follistatin
Rat(24373) follistatin
chicken(396119) follistatin
dog(479336) follistatin
Horse(100033825) follistatin
cow(327681) follistatin
Goat(100860914) follistatin
sheep(443323) follistatin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006350 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008046 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008046 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008046 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006350 Rosetta Predictions human pricing
NM_013409 Rosetta Predictions human pricing
NM_012561 Rosetta Predictions rat pricing
NM_008046 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227169 predicted 579
2 SASI_Hs01_00227170 predicted 649
3 SASI_Hs01_00227171 predicted 441
4 SASI_Hs01_00227172 predicted 547
5 SASI_Hs01_00227173 predicted 501
6 SASI_Hs01_00227174 predicted 712
7 SASI_Hs01_00227175 predicted 315
8 SASI_Hs01_00227176 predicted 745
9 SASI_Hs01_00227177 predicted 588
10 SASI_Hs02_00341391 predicted 579
11 SASI_Hs01_00227178 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029840 predicted 586
2 SASI_Hs01_00029841 predicted 646
3 SASI_Hs01_00029842 predicted 438
4 SASI_Hs01_00029843 predicted 550
5 SASI_Hs01_00029844 predicted 497
6 SASI_Hs01_00029845 predicted 706
7 SASI_Hs01_00029846 predicted 314
8 SASI_Hs01_00029847 predicted 741
9 SASI_Hs01_00029848 predicted 586
10 SASI_Hs02_00344790 predicted 578
11 SASI_Hs01_00029849 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070360 predicted 552
2 SASI_Rn01_00070361 predicted 257
3 SASI_Rn01_00070362 predicted 254
4 SASI_Rn01_00070364 predicted 474
5 SASI_Rn01_00070365 predicted 676
6 SASI_Rn01_00070366 predicted 591
7 SASI_Rn01_00070367 predicted 700
8 SASI_Rn01_00070368 predicted 625
9 SASI_Rn02_00259672 predicted 469
10 SASI_Rn01_00070369 predicted 767
11 SASI_Rn01_00070363 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160158 predicted 759
2 SASI_Mm01_00160159 predicted 750
3 SASI_Mm01_00160160 predicted 397
4 SASI_Mm01_00160161 predicted 396
5 SASI_Mm01_00160162 predicted 591
6 SASI_Mm01_00160163 predicted 942
7 SASI_Mm01_00160164 predicted 828
8 SASI_Mm01_00160165 predicted 619
9 SASI_Mm01_00160166 predicted 843
10 SASI_Mm01_00160167 predicted 707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006350
FST MISSION shRNA Bacterial Glycerol Stock
follistatin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006350.2-234s1c1
Sequence:CCGGCGTGAATGACAACACACTCTTCTCGAGAAGAGTGTGTTGTCATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006350.2-880s1c1
Sequence:CCGGGCCAGTGACAATGCCACTTATCTCGAGATAAGTGGCATTGTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006350.2-586s1c1
Sequence:CCGGGCCTACTGTGTGACCTGTAATCTCGAGATTACAGGTCACACAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006350.2-297s1c1
Sequence:CCGGCTGTAAAGAAACGTGTGAGAACTCGAGTTCTCACACGTTTCTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006350.2-705s1c1
Sequence:CCGGGCTGGGCAGATCTATTGGATTCTCGAGAATCCAATAGATCTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006350.2-974s21c1
Sequence:CCGGGCAACTGAATCTGCCCGTAAACTCGAGTTTACGGGCAGATTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006350.2-1192s21c1
Sequence:CCGGCGCTGTTGTTGTCCGTATTTACTCGAGTAAATACGGACAACAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006350.2-502s21c1
Sequence:CCGGCAGTACCAAGGCAGATGTAAACTCGAGTTTACATCTGCCTTGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006350
FST MISSION shRNA shRNA Plasmid DNA
follistatin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006350.2-234s1c1
Sequence:CCGGCGTGAATGACAACACACTCTTCTCGAGAAGAGTGTGTTGTCATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006350.2-880s1c1
Sequence:CCGGGCCAGTGACAATGCCACTTATCTCGAGATAAGTGGCATTGTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006350.2-586s1c1
Sequence:CCGGGCCTACTGTGTGACCTGTAATCTCGAGATTACAGGTCACACAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006350.2-297s1c1
Sequence:CCGGCTGTAAAGAAACGTGTGAGAACTCGAGTTCTCACACGTTTCTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006350.2-705s1c1
Sequence:CCGGGCTGGGCAGATCTATTGGATTCTCGAGAATCCAATAGATCTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006350.2-974s21c1
Sequence:CCGGGCAACTGAATCTGCCCGTAAACTCGAGTTTACGGGCAGATTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006350.2-1192s21c1
Sequence:CCGGCGCTGTTGTTGTCCGTATTTACTCGAGTAAATACGGACAACAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006350.2-502s21c1
Sequence:CCGGCAGTACCAAGGCAGATGTAAACTCGAGTTTACATCTGCCTTGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006350
FST MISSION shRNA Lentiviral Transduction Particles
follistatin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006350.2-234s1c1
Sequence:CCGGCGTGAATGACAACACACTCTTCTCGAGAAGAGTGTGTTGTCATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006350.2-880s1c1
Sequence:CCGGGCCAGTGACAATGCCACTTATCTCGAGATAAGTGGCATTGTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006350.2-586s1c1
Sequence:CCGGGCCTACTGTGTGACCTGTAATCTCGAGATTACAGGTCACACAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006350.2-297s1c1
Sequence:CCGGCTGTAAAGAAACGTGTGAGAACTCGAGTTCTCACACGTTTCTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006350.2-705s1c1
Sequence:CCGGGCTGGGCAGATCTATTGGATTCTCGAGAATCCAATAGATCTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006350.2-974s21c1
Sequence:CCGGGCAACTGAATCTGCCCGTAAACTCGAGTTTACGGGCAGATTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006350.2-1192s21c1
Sequence:CCGGCGCTGTTGTTGTCCGTATTTACTCGAGTAAATACGGACAACAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006350.2-502s21c1
Sequence:CCGGCAGTACCAAGGCAGATGTAAACTCGAGTTTACATCTGCCTTGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008046
VALIDATED
FST MISSION shRNA Bacterial Glycerol Stock
follistatin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008046.1-256s1c1
Sequence:CCGGCCCAACTGCATCCCTTGTAAACTCGAGTTTACAAGGGATGCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008046.1-127s1c1
Sequence:CCGGCAGGTCCTGTATAAGACAGAACTCGAGTTCTGTCTTATACAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008046.1-944s1c1
Sequence:CCGGGCAACTCCATCTCGGAAGAAACTCGAGTTTCTTCCGAGATGGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008046.1-199s1c1
Sequence:CCGGGAGGAGGATGTGAACGACAATCTCGAGATTGTCGTTCACATCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008046.1-316s1c1
Sequence:CCGGTGTCGAATGAACAAGAAGAATCTCGAGATTCTTCTTGTTCATTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008046.2-1382s21c1
Sequence:CCGGTCTCCCAGGCCACGTTGTTATCTCGAGATAACAACGTGGCCTGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008046.2-343s21c1
Sequence:CCGGGAGGAGGATGTGAACGACAATCTCGAGATTGTCGTTCACATCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008046.2-460s21c1
Sequence:CCGGTGTCGAATGAACAAGAAGAATCTCGAGATTCTTCTTGTTCATTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008046.2-1088s21c1
Sequence:CCGGGCAACTCCATCTCGGAAGAAACTCGAGTTTCTTCCGAGATGGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008046.2-1409s21c1
Sequence:CCGGGGCATGGAGAGATGGTCATTTCTCGAGAAATGACCATCTCTCCATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008046
VALIDATED
FST MISSION shRNA shRNA Plasmid DNA
follistatin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008046.1-256s1c1
Sequence:CCGGCCCAACTGCATCCCTTGTAAACTCGAGTTTACAAGGGATGCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008046.1-127s1c1
Sequence:CCGGCAGGTCCTGTATAAGACAGAACTCGAGTTCTGTCTTATACAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008046.1-944s1c1
Sequence:CCGGGCAACTCCATCTCGGAAGAAACTCGAGTTTCTTCCGAGATGGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008046.1-199s1c1
Sequence:CCGGGAGGAGGATGTGAACGACAATCTCGAGATTGTCGTTCACATCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008046.1-316s1c1
Sequence:CCGGTGTCGAATGAACAAGAAGAATCTCGAGATTCTTCTTGTTCATTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008046.2-1382s21c1
Sequence:CCGGTCTCCCAGGCCACGTTGTTATCTCGAGATAACAACGTGGCCTGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008046.2-343s21c1
Sequence:CCGGGAGGAGGATGTGAACGACAATCTCGAGATTGTCGTTCACATCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008046.2-460s21c1
Sequence:CCGGTGTCGAATGAACAAGAAGAATCTCGAGATTCTTCTTGTTCATTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008046.2-1088s21c1
Sequence:CCGGGCAACTCCATCTCGGAAGAAACTCGAGTTTCTTCCGAGATGGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008046.2-1409s21c1
Sequence:CCGGGGCATGGAGAGATGGTCATTTCTCGAGAAATGACCATCTCTCCATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008046
VALIDATED
FST MISSION shRNA Lentiviral Transduction Particles
follistatin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008046.1-256s1c1
Sequence:CCGGCCCAACTGCATCCCTTGTAAACTCGAGTTTACAAGGGATGCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008046.1-127s1c1
Sequence:CCGGCAGGTCCTGTATAAGACAGAACTCGAGTTCTGTCTTATACAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008046.1-944s1c1
Sequence:CCGGGCAACTCCATCTCGGAAGAAACTCGAGTTTCTTCCGAGATGGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008046.1-199s1c1
Sequence:CCGGGAGGAGGATGTGAACGACAATCTCGAGATTGTCGTTCACATCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008046.1-316s1c1
Sequence:CCGGTGTCGAATGAACAAGAAGAATCTCGAGATTCTTCTTGTTCATTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008046.2-1382s21c1
Sequence:CCGGTCTCCCAGGCCACGTTGTTATCTCGAGATAACAACGTGGCCTGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008046.2-343s21c1
Sequence:CCGGGAGGAGGATGTGAACGACAATCTCGAGATTGTCGTTCACATCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008046.2-460s21c1
Sequence:CCGGTGTCGAATGAACAAGAAGAATCTCGAGATTCTTCTTGTTCATTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008046.2-1088s21c1
Sequence:CCGGGCAACTCCATCTCGGAAGAAACTCGAGTTTCTTCCGAGATGGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008046.2-1409s21c1
Sequence:CCGGGGCATGGAGAGATGGTCATTTCTCGAGAAATGACCATCTCTCCATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks