EMAIL THIS PAGE TO A FRIEND

FSTL1

follistatin-like 1

127 Gene Product Result for
Synonyms: FRP FSL1 MIR198
UniProtKB ID: Q12841, D3DN90, Q549Z0
Gene ID:
Human(11167) Summary: This gene encodes a protein with similarity to follistatin, an activin-binding protein. It contains an FS module, a follistatin-like sequence containing 10 conserved cysteine residues. This gene product is thought to be an autoantigen associated with rheumatoid arthritis. [provided by RefSeq, Jul 2008]
Mouse(14314) follistatin-like 1
Rat(79210) follistatin-like 1
chicken(395349) follistatin-like 1
dog(608384) follistatin-like 1
cow(534482) follistatin-like 1
domestic cat(101082337) follistatin-like 1
sheep(101118330) follistatin-like 1
naked mole-rat(101697020) follistatin-like 1
domestic guinea pig(100720516) follistatin-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0320 AQUA Peptide YVQELQ[K] chicken, cow, dog, human, mouse pricing
AQ0318 AQUA Peptide HQETAE[K] cow, dog, human pricing
AQ0319 AQUA Peptide GSNYSEILD[K] cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008047 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008047 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008047 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007085 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007085 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007085 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007085 Rosetta Predictions human pricing
NM_024369 Rosetta Predictions rat pricing
NM_008047 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342923 predicted 512
2 SASI_Hs01_00132054 predicted 679
3 SASI_Hs01_00132056 predicted 1001
4 SASI_Hs01_00132057 predicted 575
5 SASI_Hs01_00132059 predicted 281
6 SASI_Hs01_00132060 predicted 606
7 SASI_Hs01_00132061 predicted 196
8 SASI_Hs02_00342924 predicted 817
9 SASI_Hs01_00132063 predicted 577
10 SASI_Hs02_00342925 predicted 998
11 SASI_Hs01_00132055 predicted 1054
12 SASI_Hs01_00132058 predicted 1105
13 SASI_Hs01_00132062 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118484 predicted 522
2 SASI_Rn01_00118485 predicted 273
3 SASI_Rn01_00118486 predicted 342
4 SASI_Rn01_00118488 predicted 578
5 SASI_Rn01_00118489 predicted 542
6 SASI_Rn01_00118490 predicted 971
7 SASI_Rn02_00263957 predicted 660
8 SASI_Rn01_00118491 predicted 231
9 SASI_Rn01_00118493 predicted 417
10 SASI_Rn02_00263958 predicted 985
11 SASI_Rn01_00118487 predicted 757
12 SASI_Rn01_00118492 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008047 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107056 predicted 618
2 SASI_Mm01_00107058 predicted 875
3 SASI_Mm01_00107059 predicted 673
4 SASI_Mm01_00107060 predicted 349
5 SASI_Mm01_00107061 predicted 351
6 SASI_Mm01_00107062 predicted 762
7 SASI_Mm02_00313009 predicted 283
8 SASI_Mm01_00107063 predicted 347
9 SASI_Mm01_00107064 predicted 1089
10 SASI_Mm01_00107065 predicted 315
11 SASI_Mm01_00107057 predicted 1059
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008047
VALIDATED
FSTL1 MISSION shRNA Bacterial Glycerol Stock
follistatin-like 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008047.5-1206s21c1
Sequence:CCGGCACCTGTAGGAATGCTTTAAGCTCGAGCTTAAAGCATTCCTACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008047.5-353s21c1
Sequence:CCGGATCCAAGATCCAGGTTGATTACTCGAGTAATCAACCTGGATCTTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008047.2-1297s1c1
Sequence:CCGGGCAGGTTTGAATGAAGCCTTTCTCGAGAAAGGCTTCATTCAAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008047.2-516s1c1
Sequence:CCGGAGGCAGTAACTACAGTGAGATCTCGAGATCTCACTGTAGTTACTGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008047.2-612s1c1
Sequence:CCGGGCAGAATGAAACAGCCATCAACTCGAGTTGATGGCTGTTTCATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008047.2-250s1c1
Sequence:CCGGCTCTGCATTGAGCAATGCAAACTCGAGTTTGCATTGCTCAATGCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008047.2-996s1c1
Sequence:CCGGGAAGGTGAACACCAAAGAGATCTCGAGATCTCTTTGGTGTTCACCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008047
VALIDATED
FSTL1 MISSION shRNA shRNA Plasmid DNA
follistatin-like 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008047.5-1206s21c1
Sequence:CCGGCACCTGTAGGAATGCTTTAAGCTCGAGCTTAAAGCATTCCTACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008047.5-353s21c1
Sequence:CCGGATCCAAGATCCAGGTTGATTACTCGAGTAATCAACCTGGATCTTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008047.2-1297s1c1
Sequence:CCGGGCAGGTTTGAATGAAGCCTTTCTCGAGAAAGGCTTCATTCAAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008047.2-516s1c1
Sequence:CCGGAGGCAGTAACTACAGTGAGATCTCGAGATCTCACTGTAGTTACTGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008047.2-612s1c1
Sequence:CCGGGCAGAATGAAACAGCCATCAACTCGAGTTGATGGCTGTTTCATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008047.2-250s1c1
Sequence:CCGGCTCTGCATTGAGCAATGCAAACTCGAGTTTGCATTGCTCAATGCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008047.2-996s1c1
Sequence:CCGGGAAGGTGAACACCAAAGAGATCTCGAGATCTCTTTGGTGTTCACCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008047
VALIDATED
FSTL1 MISSION shRNA Lentiviral Transduction Particles
follistatin-like 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008047.5-1206s21c1
Sequence:CCGGCACCTGTAGGAATGCTTTAAGCTCGAGCTTAAAGCATTCCTACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008047.5-353s21c1
Sequence:CCGGATCCAAGATCCAGGTTGATTACTCGAGTAATCAACCTGGATCTTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008047.2-1297s1c1
Sequence:CCGGGCAGGTTTGAATGAAGCCTTTCTCGAGAAAGGCTTCATTCAAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008047.2-516s1c1
Sequence:CCGGAGGCAGTAACTACAGTGAGATCTCGAGATCTCACTGTAGTTACTGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008047.2-612s1c1
Sequence:CCGGGCAGAATGAAACAGCCATCAACTCGAGTTGATGGCTGTTTCATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008047.2-250s1c1
Sequence:CCGGCTCTGCATTGAGCAATGCAAACTCGAGTTTGCATTGCTCAATGCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008047.2-996s1c1
Sequence:CCGGGAAGGTGAACACCAAAGAGATCTCGAGATCTCTTTGGTGTTCACCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007085
VALIDATED
FSTL1 MISSION shRNA Bacterial Glycerol Stock
follistatin-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007085.4-362s21c1
Sequence:CCGGAGGCCTGTGTGTGGCAGTAATCTCGAGATTACTGCCACACACAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007085.4-1185s21c1
Sequence:CCGGGTCGCCAAATCACCAGTATTTCTCGAGAAATACTGGTGATTTGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007085.4-707s21c1
Sequence:CCGGGCCATCAATATTACAACGTATCTCGAGATACGTTGTAATATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007085.4-445s21c1
Sequence:CCGGCCAGGTTGATTACGATGGACACTCGAGTGTCCATCGTAATCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007085.4-244s21c1
Sequence:CCGGGCTAAGGAGCAAATCCAAGATCTCGAGATCTTGGATTTGCTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007085.3-614s1c1
Sequence:CCGGGCCATCAATATTACAACGTATCTCGAGATACGTTGTAATATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007085.3-710s1c1
Sequence:CCGGGATTGGAAACTCAGCTTCCAACTCGAGTTGGAAGCTGAGTTTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007085.3-151s1c1
Sequence:CCGGGCTAAGGAGCAAATCCAAGATCTCGAGATCTTGGATTTGCTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007085.3-352s1c1
Sequence:CCGGCCAGGTTGATTACGATGGACACTCGAGTGTCCATCGTAATCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007085
VALIDATED
FSTL1 MISSION shRNA shRNA Plasmid DNA
follistatin-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007085.4-362s21c1
Sequence:CCGGAGGCCTGTGTGTGGCAGTAATCTCGAGATTACTGCCACACACAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007085.4-1185s21c1
Sequence:CCGGGTCGCCAAATCACCAGTATTTCTCGAGAAATACTGGTGATTTGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007085.4-707s21c1
Sequence:CCGGGCCATCAATATTACAACGTATCTCGAGATACGTTGTAATATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007085.4-445s21c1
Sequence:CCGGCCAGGTTGATTACGATGGACACTCGAGTGTCCATCGTAATCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007085.4-244s21c1
Sequence:CCGGGCTAAGGAGCAAATCCAAGATCTCGAGATCTTGGATTTGCTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007085.3-614s1c1
Sequence:CCGGGCCATCAATATTACAACGTATCTCGAGATACGTTGTAATATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007085.3-710s1c1
Sequence:CCGGGATTGGAAACTCAGCTTCCAACTCGAGTTGGAAGCTGAGTTTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007085.3-151s1c1
Sequence:CCGGGCTAAGGAGCAAATCCAAGATCTCGAGATCTTGGATTTGCTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007085.3-352s1c1
Sequence:CCGGCCAGGTTGATTACGATGGACACTCGAGTGTCCATCGTAATCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007085
VALIDATED
FSTL1 MISSION shRNA Lentiviral Transduction Particles
follistatin-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007085.4-362s21c1
Sequence:CCGGAGGCCTGTGTGTGGCAGTAATCTCGAGATTACTGCCACACACAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007085.4-1185s21c1
Sequence:CCGGGTCGCCAAATCACCAGTATTTCTCGAGAAATACTGGTGATTTGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007085.4-707s21c1
Sequence:CCGGGCCATCAATATTACAACGTATCTCGAGATACGTTGTAATATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007085.4-445s21c1
Sequence:CCGGCCAGGTTGATTACGATGGACACTCGAGTGTCCATCGTAATCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007085.4-244s21c1
Sequence:CCGGGCTAAGGAGCAAATCCAAGATCTCGAGATCTTGGATTTGCTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007085.3-614s1c1
Sequence:CCGGGCCATCAATATTACAACGTATCTCGAGATACGTTGTAATATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007085.3-710s1c1
Sequence:CCGGGATTGGAAACTCAGCTTCCAACTCGAGTTGGAAGCTGAGTTTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007085.3-151s1c1
Sequence:CCGGGCTAAGGAGCAAATCCAAGATCTCGAGATCTTGGATTTGCTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007085.3-352s1c1
Sequence:CCGGCCAGGTTGATTACGATGGACACTCGAGTGTCCATCGTAATCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks