EMAIL THIS PAGE TO A FRIEND

FSTL3

follistatin-like 3 (secreted glycoprotein)

80 Gene Product Result for
Synonyms: FLRG FSRP
UniProtKB ID: O95633, A8K7E3
Gene ID:
Human(10272) Summary: Follistatin-like 3 is a secreted glycoprotein of the follistatin-module-protein family. It may have a role in leukemogenesis. [provided by RefSeq, Jul 2008]
Mouse(83554) follistatin-like 3
Rat(114031) follistatin-like 3 (secreted glycoprotein)
Zebrafish(557352) follistatin-like 3 (secreted glycoprotein)
chicken(770427) follistatin-like 3 (secreted glycoprotein)
dog(612399) follistatin-like 3 (secreted glycoprotein)
cow(515367) follistatin-like 3 (secreted glycoprotein)
domestic cat(101091763) follistatin-like 3 (secreted glycoprotein)
domestic guinea pig(100723577) follistatin-like 3 (secreted glycoprotein)
naked mole-rat(101718543) follistatin-like 3 (secreted glycoprotein)
sheep(101109272) follistatin-like 3 (secreted glycoprotein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031380 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031380 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031380 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005860 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005860 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005860 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005860 Rosetta Predictions human pricing
NM_053629 Rosetta Predictions rat pricing
NM_031380 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236481 predicted 669
2 SASI_Hs01_00236482 predicted 956
3 SASI_Hs02_00340419 predicted 286
4 SASI_Hs01_00236483 predicted 1255
5 SASI_Hs01_00236484 predicted 1172
6 SASI_Hs01_00236485 predicted 1145
7 SASI_Hs01_00236487 predicted 890
8 SASI_Hs01_00236488 predicted 1034
9 SASI_Hs01_00236489 predicted 207
10 SASI_Hs01_00236490 predicted 565
11 SASI_Hs01_00236486 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049977 predicted 459
2 SASI_Rn02_00266333 predicted 336
3 SASI_Rn02_00266334 predicted 211
4 SASI_Rn02_00266335 predicted 259
5 SASI_Rn02_00266336 predicted 407
6 SASI_Rn02_00266337 predicted 409
7 SASI_Rn02_00266338 predicted 477
8 SASI_Rn02_00266339 predicted 277
9 SASI_Rn02_00266340 predicted 439
10 SASI_Rn02_00266341 predicted 544
11 SASI_Rn01_00049976 predicted 1218
12 SASI_Rn01_00049978 predicted 636
13 SASI_Rn01_00049979 predicted 1179
14 SASI_Rn01_00049980 predicted 259
15 SASI_Rn01_00049981 predicted 1193
16 SASI_Rn01_00049982 predicted 639
17 SASI_Rn01_00049983 predicted 1104
18 SASI_Rn01_00049984 predicted 1272
19 SASI_Rn01_00049985 predicted 1243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337122 predicted 1127
2 SASI_Mm02_00337123 predicted 1083
3 SASI_Mm02_00337124 predicted 893
4 SASI_Mm01_00160973 predicted 795
5 SASI_Mm02_00337125 predicted 1233
6 SASI_Mm01_00160975 predicted 614
7 SASI_Mm01_00160976 predicted 911
8 SASI_Mm01_00160978 predicted 1156
9 SASI_Mm02_00337126 predicted 1179
10 SASI_Mm01_00160979 predicted 251
11 SASI_Mm01_00160972 predicted 475
12 SASI_Mm01_00160974 predicted 846
13 SASI_Mm01_00160977 predicted 630
14 SASI_Mm01_00160980 predicted 869
15 SASI_Mm01_00160981 predicted 221
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031380
FSTL3 MISSION shRNA Bacterial Glycerol Stock
follistatin-like 3 (secreted glycoprotein)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000080343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031380.1-1406s1c1
Sequence:CCGGGCCAGACTGAATTACTGCCTTCTCGAGAAGGCAGTAATTCAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031380.1-621s1c1
Sequence:CCGGCCAAGAACTCTGTGGCAACAACTCGAGTTGTTGCCACAGAGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031380.1-646s1c1
Sequence:CCGGGTTACCTACATCTCGTCGTGTCTCGAGACACGACGAGATGTAGGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031380.1-468s1c1
Sequence:CCGGCCCAGACTTGCGCGTCATGTACTCGAGTACATGACGCGCAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031380
FSTL3 MISSION shRNA shRNA Plasmid DNA
follistatin-like 3 (secreted glycoprotein)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000080343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031380.1-1406s1c1
Sequence:CCGGGCCAGACTGAATTACTGCCTTCTCGAGAAGGCAGTAATTCAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031380.1-621s1c1
Sequence:CCGGCCAAGAACTCTGTGGCAACAACTCGAGTTGTTGCCACAGAGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031380.1-646s1c1
Sequence:CCGGGTTACCTACATCTCGTCGTGTCTCGAGACACGACGAGATGTAGGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031380.1-468s1c1
Sequence:CCGGCCCAGACTTGCGCGTCATGTACTCGAGTACATGACGCGCAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031380
FSTL3 MISSION shRNA Lentiviral Transduction Particles
follistatin-like 3 (secreted glycoprotein)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000080343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031380.1-1406s1c1
Sequence:CCGGGCCAGACTGAATTACTGCCTTCTCGAGAAGGCAGTAATTCAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031380.1-621s1c1
Sequence:CCGGCCAAGAACTCTGTGGCAACAACTCGAGTTGTTGCCACAGAGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031380.1-646s1c1
Sequence:CCGGGTTACCTACATCTCGTCGTGTCTCGAGACACGACGAGATGTAGGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031380.1-468s1c1
Sequence:CCGGCCCAGACTTGCGCGTCATGTACTCGAGTACATGACGCGCAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005860
VALIDATED
FSTL3 MISSION shRNA Bacterial Glycerol Stock
follistatin-like 3 (secreted glycoprotein)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005860.1-475s1c1
Sequence:CCGGCCCGGACCTGAGCGTCATGTACTCGAGTACATGACGCTCAGGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005860.1-640s1c1
Sequence:CCGGCGGCAACAACAACGTCACCTACTCGAGTAGGTGACGTTGTTGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005860.1-860s1c1
Sequence:CCGGGCCACAGCAGAGTCTAATTTACTCGAGTAAATTAGACTCTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005860.2-274s21c1
Sequence:CCGGAGATCAACCTCCTCGGCTTCTCTCGAGAGAAGCCGAGGAGGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005860.2-309s21c1
Sequence:CCGGTGCCTTCCCTGCAAAGATTCGCTCGAGCGAATCTTTGCAGGGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005860.2-503s21c1
Sequence:CCGGCCCGGACCTGAGCGTCATGTACTCGAGTACATGACGCTCAGGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005860.2-888s21c1
Sequence:CCGGGCCACAGCAGAGTCTAATTTACTCGAGTAAATTAGACTCTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005860.2-808s21c1
Sequence:CCGGAGGAAGAGAACTTCGTGTGAGCTCGAGCTCACACGAAGTTCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005860.1-198s1c2
Sequence:CCGGCCGGCAACATTGACACCGCCTCTCGAGAGGCGGTGTCAATGTTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005860
VALIDATED
FSTL3 MISSION shRNA shRNA Plasmid DNA
follistatin-like 3 (secreted glycoprotein)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005860.1-475s1c1
Sequence:CCGGCCCGGACCTGAGCGTCATGTACTCGAGTACATGACGCTCAGGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005860.1-640s1c1
Sequence:CCGGCGGCAACAACAACGTCACCTACTCGAGTAGGTGACGTTGTTGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005860.1-860s1c1
Sequence:CCGGGCCACAGCAGAGTCTAATTTACTCGAGTAAATTAGACTCTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005860.2-274s21c1
Sequence:CCGGAGATCAACCTCCTCGGCTTCTCTCGAGAGAAGCCGAGGAGGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005860.2-309s21c1
Sequence:CCGGTGCCTTCCCTGCAAAGATTCGCTCGAGCGAATCTTTGCAGGGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005860.2-503s21c1
Sequence:CCGGCCCGGACCTGAGCGTCATGTACTCGAGTACATGACGCTCAGGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005860.2-888s21c1
Sequence:CCGGGCCACAGCAGAGTCTAATTTACTCGAGTAAATTAGACTCTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005860.2-808s21c1
Sequence:CCGGAGGAAGAGAACTTCGTGTGAGCTCGAGCTCACACGAAGTTCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005860.1-198s1c2
Sequence:CCGGCCGGCAACATTGACACCGCCTCTCGAGAGGCGGTGTCAATGTTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005860
VALIDATED
FSTL3 MISSION shRNA Lentiviral Transduction Particles
follistatin-like 3 (secreted glycoprotein)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005860.1-475s1c1
Sequence:CCGGCCCGGACCTGAGCGTCATGTACTCGAGTACATGACGCTCAGGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005860.1-640s1c1
Sequence:CCGGCGGCAACAACAACGTCACCTACTCGAGTAGGTGACGTTGTTGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005860.1-860s1c1
Sequence:CCGGGCCACAGCAGAGTCTAATTTACTCGAGTAAATTAGACTCTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005860.2-274s21c1
Sequence:CCGGAGATCAACCTCCTCGGCTTCTCTCGAGAGAAGCCGAGGAGGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005860.2-309s21c1
Sequence:CCGGTGCCTTCCCTGCAAAGATTCGCTCGAGCGAATCTTTGCAGGGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005860.2-503s21c1
Sequence:CCGGCCCGGACCTGAGCGTCATGTACTCGAGTACATGACGCTCAGGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005860.2-888s21c1
Sequence:CCGGGCCACAGCAGAGTCTAATTTACTCGAGTAAATTAGACTCTGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005860.2-808s21c1
Sequence:CCGGAGGAAGAGAACTTCGTGTGAGCTCGAGCTCACACGAAGTTCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005860.1-198s1c2
Sequence:CCGGCCGGCAACATTGACACCGCCTCTCGAGAGGCGGTGTCAATGTTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks