EMAIL THIS PAGE TO A FRIEND

FSTL4

follistatin-like 4

93 Gene Product Result for
UniProtKB ID: Q6MZW2, Q8TBU0, Q9UPU1
Gene ID:
Mouse(320027) follistatin-like 4
Rat(303130) follistatin-like 4
sheep(101123036) follistatin-like 4
Domestic Rabbit(100338307) follistatin-like 4
naked mole-rat(101709902) follistatin-like 4
domestic guinea pig(100735893) follistatin-like 4
Zebrafish(571664) follistatin-like 4
cow(540809) follistatin-like 4
Horse(100063004) follistatin-like 4
domestic cat(101098032) follistatin-like 4
dog(481504) follistatin-like 4
chicken(395163) follistatin-like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_048786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_048786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_048786 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177059 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177059 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177059 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086341 MISSION® esiRNA esiRNA human FSTL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015082 Rosetta Predictions human pricing
NM_001107000 Rosetta Predictions rat pricing
NM_177059 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200383 predicted 2386
2 SASI_Hs01_00200384 predicted 1051
3 SASI_Hs01_00200385 predicted 2394
4 SASI_Hs01_00200386 predicted 883
5 SASI_Hs01_00200387 predicted 1561
6 SASI_Hs01_00200388 predicted 2847
7 SASI_Hs01_00200389 predicted 2057
8 SASI_Hs01_00200390 predicted 1730
9 SASI_Hs01_00200391 predicted 920
10 SASI_Hs01_00200392 predicted 2035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224496 predicted 897
2 SASI_Rn02_00224497 predicted 2293
3 SASI_Rn02_00224498 predicted 777
4 SASI_Rn02_00224499 predicted 324
5 SASI_Rn02_00224500 predicted 1495
6 SASI_Rn02_00224501 predicted 1552
7 SASI_Rn02_00224502 predicted 1340
8 SASI_Rn02_00224503 predicted 2424
9 SASI_Rn02_00224504 predicted 2444
10 SASI_Rn02_00224505 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154590 predicted 1880
2 SASI_Mm01_00154591 predicted 1016
3 SASI_Mm01_00154592 predicted 1450
4 SASI_Mm01_00154593 predicted 1620
5 SASI_Mm01_00154594 predicted 1700
6 SASI_Mm01_00154595 predicted 1944
7 SASI_Mm01_00154596 predicted 819
8 SASI_Mm01_00154597 predicted 841
9 SASI_Mm01_00154598 predicted 2416
10 SASI_Mm02_00347020 predicted 1017
11 SASI_Mm01_00154589 predicted 1613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_048786
VALIDATED
FSTL4 MISSION shRNA Bacterial Glycerol Stock
follistatin-like 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:XM_048786.5-913s1c1
Sequence:CCGGCCTCCGATTTGACGATTACAACTCGAGTTGTAATCGTCAAATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:XM_048786.5-2475s1c1
Sequence:CCGGCCTTCACTGAAAGCAATCAATCTCGAGATTGATTGCTTTCAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_048786.5-686s1c1
Sequence:CCGGGCCCGCTTGAAGAATGTCCTTCTCGAGAAGGACATTCTTCAAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_048786.5-1384s1c1
Sequence:CCGGCGTGGATGTCTCAACTCAGATCTCGAGATCTGAGTTGAGACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:XM_048786.5-2431s1c1
Sequence:CCGGCCTGCAAATAAACTCGGGCATCTCGAGATGCCCGAGTTTATTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_048786
VALIDATED
FSTL4 MISSION shRNA shRNA Plasmid DNA
follistatin-like 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:XM_048786.5-913s1c1
Sequence:CCGGCCTCCGATTTGACGATTACAACTCGAGTTGTAATCGTCAAATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:XM_048786.5-2475s1c1
Sequence:CCGGCCTTCACTGAAAGCAATCAATCTCGAGATTGATTGCTTTCAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_048786.5-686s1c1
Sequence:CCGGGCCCGCTTGAAGAATGTCCTTCTCGAGAAGGACATTCTTCAAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_048786.5-1384s1c1
Sequence:CCGGCGTGGATGTCTCAACTCAGATCTCGAGATCTGAGTTGAGACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:XM_048786.5-2431s1c1
Sequence:CCGGCCTGCAAATAAACTCGGGCATCTCGAGATGCCCGAGTTTATTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_048786
VALIDATED
FSTL4 MISSION shRNA Lentiviral Transduction Particles
follistatin-like 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:XM_048786.5-913s1c1
Sequence:CCGGCCTCCGATTTGACGATTACAACTCGAGTTGTAATCGTCAAATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:XM_048786.5-2475s1c1
Sequence:CCGGCCTTCACTGAAAGCAATCAATCTCGAGATTGATTGCTTTCAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_048786.5-686s1c1
Sequence:CCGGGCCCGCTTGAAGAATGTCCTTCTCGAGAAGGACATTCTTCAAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_048786.5-1384s1c1
Sequence:CCGGCGTGGATGTCTCAACTCAGATCTCGAGATCTGAGTTGAGACATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:XM_048786.5-2431s1c1
Sequence:CCGGCCTGCAAATAAACTCGGGCATCTCGAGATGCCCGAGTTTATTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177059
FSTL4 MISSION shRNA Bacterial Glycerol Stock
follistatin-like 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177059.3-847s1c1
Sequence:CCGGCCTGCGATTTGATGACTATAACTCGAGTTATAGTCATCAAATCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177059.3-2914s1c1
Sequence:CCGGGCAACCAAGATTGGGTGGTTTCTCGAGAAACCACCCAATCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177059.3-2350s1c1
Sequence:CCGGCCAGACGCTATACGACCTAAACTCGAGTTTAGGTCGTATAGCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177059.3-1291s1c1
Sequence:CCGGGCCCAGAATCATTTGGCTGAACTCGAGTTCAGCCAAATGATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177059.3-1981s1c1
Sequence:CCGGGCCAACAAATCTCATCATCAACTCGAGTTGATGATGAGATTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177059
FSTL4 MISSION shRNA shRNA Plasmid DNA
follistatin-like 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177059.3-847s1c1
Sequence:CCGGCCTGCGATTTGATGACTATAACTCGAGTTATAGTCATCAAATCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177059.3-2914s1c1
Sequence:CCGGGCAACCAAGATTGGGTGGTTTCTCGAGAAACCACCCAATCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177059.3-2350s1c1
Sequence:CCGGCCAGACGCTATACGACCTAAACTCGAGTTTAGGTCGTATAGCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177059.3-1291s1c1
Sequence:CCGGGCCCAGAATCATTTGGCTGAACTCGAGTTCAGCCAAATGATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177059.3-1981s1c1
Sequence:CCGGGCCAACAAATCTCATCATCAACTCGAGTTGATGATGAGATTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177059
FSTL4 MISSION shRNA Lentiviral Transduction Particles
follistatin-like 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177059.3-847s1c1
Sequence:CCGGCCTGCGATTTGATGACTATAACTCGAGTTATAGTCATCAAATCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177059.3-2914s1c1
Sequence:CCGGGCAACCAAGATTGGGTGGTTTCTCGAGAAACCACCCAATCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177059.3-2350s1c1
Sequence:CCGGCCAGACGCTATACGACCTAAACTCGAGTTTAGGTCGTATAGCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177059.3-1291s1c1
Sequence:CCGGGCCCAGAATCATTTGGCTGAACTCGAGTTCAGCCAAATGATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177059.3-1981s1c1
Sequence:CCGGGCCAACAAATCTCATCATCAACTCGAGTTGATGATGAGATTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks