EMAIL THIS PAGE TO A FRIEND

FSTL5

follistatin-like 5

162 Gene Product Result for
UniProtKB ID: Q8N475, E9PCP6, Q9NSW7, Q9ULF7
Gene ID:
Mouse(213262) follistatin-like 5
Rat(365823) follistatin-like 5
Zebrafish(566192) follistatin-like 5
cow(782831) follistatin-like 5
Horse(100061754) follistatin-like 5
Zebrafish(100148398) follistatin-like 5
dog(482671) follistatin-like 5
chicken(428726) follistatin-like 5
domestic guinea pig(100730497) follistatin-like 5
naked mole-rat(101720993) follistatin-like 5
sheep(101105281) follistatin-like 5
Domestic Rabbit(100341308) follistatin-like 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020116 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015551 MISSION® esiRNA esiRNA targeting human FSTL5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128427 Rosetta Predictions human pricing
NM_001128428 Rosetta Predictions human pricing
NM_020116 Rosetta Predictions human pricing
NM_001108946 Rosetta Predictions rat pricing
NM_178673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331156 predicted 1562
2 SASI_Hs02_00331157 predicted 2684
3 SASI_Hs02_00331158 predicted 1673
4 SASI_Hs02_00331159 predicted 1742
5 SASI_Hs02_00331160 predicted 689
6 SASI_Hs02_00331161 predicted 1649
7 SASI_Hs02_00331162 predicted 1820
8 SASI_Hs02_00331163 predicted 998
9 SASI_Hs02_00331164 predicted 1147
10 SASI_Hs02_00331165 predicted 2936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331166 predicted 1570
2 SASI_Hs02_00331167 predicted 2658
3 SASI_Hs02_00331168 predicted 1676
4 SASI_Hs02_00331169 predicted 692
5 SASI_Hs02_00331170 predicted 1645
6 SASI_Hs02_00331171 predicted 1793
7 SASI_Hs02_00331172 predicted 993
8 SASI_Hs02_00331173 predicted 1152
9 SASI_Hs02_00331174 predicted 2915
10 SASI_Hs02_00331175 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352971 predicted 1567
2 SASI_Hs01_00050461 predicted 2684
3 SASI_Hs02_00352972 predicted 1675
4 SASI_Hs01_00050462 predicted 1747
5 SASI_Hs02_00352973 predicted 694
6 SASI_Hs01_00050463 predicted 1649
7 SASI_Hs01_00050465 predicted 1826
8 SASI_Hs01_00050467 predicted 1003
9 SASI_Hs02_00352974 predicted 1157
10 SASI_Hs02_00352975 predicted 2940
11 SASI_Hs01_00050460 predicted 1352
12 SASI_Hs01_00050464 predicted 1785
13 SASI_Hs01_00050466 predicted 1399
14 SASI_Hs01_00050468 predicted 1376
15 SASI_Hs01_00050469 predicted 2078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108946 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243644 predicted 1391
2 SASI_Rn02_00243645 predicted 1442
3 SASI_Rn02_00243646 predicted 986
4 SASI_Rn02_00243647 predicted 1354
5 SASI_Rn02_00243648 predicted 1097
6 SASI_Rn02_00243649 predicted 1293
7 SASI_Rn02_00243650 predicted 1015
8 SASI_Rn02_00243651 predicted 817
9 SASI_Rn02_00243652 predicted 829
10 SASI_Rn02_00243653 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349135 predicted 2457
2 SASI_Mm01_00136377 predicted 1698
3 SASI_Mm01_00136379 predicted 1944
4 SASI_Mm01_00136381 predicted 2099
5 SASI_Mm01_00136382 predicted 958
6 SASI_Mm01_00136383 predicted 979
7 SASI_Mm01_00136384 predicted 1775
8 SASI_Mm02_00349136 predicted 1346
9 SASI_Mm01_00136385 predicted 1440
10 SASI_Mm01_00136386 predicted 1585
11 SASI_Mm01_00136378 predicted 1743
12 SASI_Mm01_00136380 predicted 2021
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020116
FSTL5 MISSION shRNA Bacterial Glycerol Stock
follistatin-like 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020116.2-1752s1c1
Sequence:CCGGGCTAACATATTATGGAGAGAACTCGAGTTCTCTCCATAATATGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020116.2-501s1c1
Sequence:CCGGCCAACCAAAGAAGGAGGATATCTCGAGATATCCTCCTTCTTTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020116.2-686s1c1
Sequence:CCGGGCAAGCAGAATGTGCCTGTATCTCGAGATACAGGCACATTCTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020116.2-1992s1c1
Sequence:CCGGCCAACTTTGGACAGAGTCCTTCTCGAGAAGGACTCTGTCCAAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020116.2-1002s1c1
Sequence:CCGGGCAGACAGTAATGGACTTGTACTCGAGTACAAGTCCATTACTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020116.3-2139s21c1
Sequence:CCGGCACCAACACTACAGGTAATTACTCGAGTAATTACCTGTAGTGTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020116.3-541s21c1
Sequence:CCGGTCTAATGAGATTGCGACATAACTCGAGTTATGTCGCAATCTCATTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020116.3-2896s21c1
Sequence:CCGGCCTAGATGGACGACTCAATAACTCGAGTTATTGAGTCGTCCATCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020116.3-3285s21c1
Sequence:CCGGGGGAATTTCAGATGACATAAACTCGAGTTTATGTCATCTGAAATTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020116
FSTL5 MISSION shRNA shRNA Plasmid DNA
follistatin-like 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020116.2-1752s1c1
Sequence:CCGGGCTAACATATTATGGAGAGAACTCGAGTTCTCTCCATAATATGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020116.2-501s1c1
Sequence:CCGGCCAACCAAAGAAGGAGGATATCTCGAGATATCCTCCTTCTTTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020116.2-686s1c1
Sequence:CCGGGCAAGCAGAATGTGCCTGTATCTCGAGATACAGGCACATTCTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020116.2-1992s1c1
Sequence:CCGGCCAACTTTGGACAGAGTCCTTCTCGAGAAGGACTCTGTCCAAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020116.2-1002s1c1
Sequence:CCGGGCAGACAGTAATGGACTTGTACTCGAGTACAAGTCCATTACTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020116.3-2139s21c1
Sequence:CCGGCACCAACACTACAGGTAATTACTCGAGTAATTACCTGTAGTGTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020116.3-541s21c1
Sequence:CCGGTCTAATGAGATTGCGACATAACTCGAGTTATGTCGCAATCTCATTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020116.3-2896s21c1
Sequence:CCGGCCTAGATGGACGACTCAATAACTCGAGTTATTGAGTCGTCCATCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020116.3-3285s21c1
Sequence:CCGGGGGAATTTCAGATGACATAAACTCGAGTTTATGTCATCTGAAATTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020116
FSTL5 MISSION shRNA Lentiviral Transduction Particles
follistatin-like 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020116.2-1752s1c1
Sequence:CCGGGCTAACATATTATGGAGAGAACTCGAGTTCTCTCCATAATATGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020116.2-501s1c1
Sequence:CCGGCCAACCAAAGAAGGAGGATATCTCGAGATATCCTCCTTCTTTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020116.2-686s1c1
Sequence:CCGGGCAAGCAGAATGTGCCTGTATCTCGAGATACAGGCACATTCTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020116.2-1992s1c1
Sequence:CCGGCCAACTTTGGACAGAGTCCTTCTCGAGAAGGACTCTGTCCAAAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020116.2-1002s1c1
Sequence:CCGGGCAGACAGTAATGGACTTGTACTCGAGTACAAGTCCATTACTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020116.3-2139s21c1
Sequence:CCGGCACCAACACTACAGGTAATTACTCGAGTAATTACCTGTAGTGTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020116.3-541s21c1
Sequence:CCGGTCTAATGAGATTGCGACATAACTCGAGTTATGTCGCAATCTCATTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020116.3-2896s21c1
Sequence:CCGGCCTAGATGGACGACTCAATAACTCGAGTTATTGAGTCGTCCATCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020116.3-3285s21c1
Sequence:CCGGGGGAATTTCAGATGACATAAACTCGAGTTTATGTCATCTGAAATTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178673
FSTL5 MISSION shRNA Bacterial Glycerol Stock
follistatin-like 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178673.3-1708s1c1
Sequence:CCGGGCTAACATATTATGGAGAGAACTCGAGTTCTCTCCATAATATGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178673.3-655s1c1
Sequence:CCGGGCCTGCATGGACCTTTGTAAACTCGAGTTTACAAAGGTCCATGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191776    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178673.3-3446s1c1
Sequence:CCGGGCAATGAATCTACTGTCATTACTCGAGTAATGACAGTAGATTCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178673.3-3528s21c1
Sequence:CCGGTGTCATGTGAAGGCATAATTTCTCGAGAAATTATGCCTTCACATGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178673.3-2937s21c1
Sequence:CCGGAGGAGCCCTCTTACCTAATTACTCGAGTAATTAGGTAAGAGGGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178673.3-1588s1c1
Sequence:CCGGCACATAAGCAATGTCCGTTATCTCGAGATAACGGACATTGCTTATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178673.3-988s1c1
Sequence:CCGGGAACTAACTCAGGTGATTAAACTCGAGTTTAATCACCTGAGTTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178673.3-988s21c1
Sequence:CCGGGAACTAACTCAGGTGATTAAACTCGAGTTTAATCACCTGAGTTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178673.3-2011s21c1
Sequence:CCGGACAGATCCTGTACCAGTTAAACTCGAGTTTAACTGGTACAGGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178673.3-2589s21c1
Sequence:CCGGCATCCACACCAACCTACATATCTCGAGATATGTAGGTTGGTGTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178673
FSTL5 MISSION shRNA shRNA Plasmid DNA
follistatin-like 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178673.3-1708s1c1
Sequence:CCGGGCTAACATATTATGGAGAGAACTCGAGTTCTCTCCATAATATGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178673.3-655s1c1
Sequence:CCGGGCCTGCATGGACCTTTGTAAACTCGAGTTTACAAAGGTCCATGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191776    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178673.3-3446s1c1
Sequence:CCGGGCAATGAATCTACTGTCATTACTCGAGTAATGACAGTAGATTCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178673.3-3528s21c1
Sequence:CCGGTGTCATGTGAAGGCATAATTTCTCGAGAAATTATGCCTTCACATGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178673.3-2937s21c1
Sequence:CCGGAGGAGCCCTCTTACCTAATTACTCGAGTAATTAGGTAAGAGGGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178673.3-1588s1c1
Sequence:CCGGCACATAAGCAATGTCCGTTATCTCGAGATAACGGACATTGCTTATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178673.3-988s1c1
Sequence:CCGGGAACTAACTCAGGTGATTAAACTCGAGTTTAATCACCTGAGTTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178673.3-988s21c1
Sequence:CCGGGAACTAACTCAGGTGATTAAACTCGAGTTTAATCACCTGAGTTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178673.3-2011s21c1
Sequence:CCGGACAGATCCTGTACCAGTTAAACTCGAGTTTAACTGGTACAGGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178673.3-2589s21c1
Sequence:CCGGCATCCACACCAACCTACATATCTCGAGATATGTAGGTTGGTGTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178673
FSTL5 MISSION shRNA Lentiviral Transduction Particles
follistatin-like 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178673.3-1708s1c1
Sequence:CCGGGCTAACATATTATGGAGAGAACTCGAGTTCTCTCCATAATATGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178673.3-655s1c1
Sequence:CCGGGCCTGCATGGACCTTTGTAAACTCGAGTTTACAAAGGTCCATGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191776    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178673.3-3446s1c1
Sequence:CCGGGCAATGAATCTACTGTCATTACTCGAGTAATGACAGTAGATTCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178673.3-3528s21c1
Sequence:CCGGTGTCATGTGAAGGCATAATTTCTCGAGAAATTATGCCTTCACATGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178673.3-2937s21c1
Sequence:CCGGAGGAGCCCTCTTACCTAATTACTCGAGTAATTAGGTAAGAGGGCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178673.3-1588s1c1
Sequence:CCGGCACATAAGCAATGTCCGTTATCTCGAGATAACGGACATTGCTTATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178673.3-988s1c1
Sequence:CCGGGAACTAACTCAGGTGATTAAACTCGAGTTTAATCACCTGAGTTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178673.3-988s21c1
Sequence:CCGGGAACTAACTCAGGTGATTAAACTCGAGTTTAATCACCTGAGTTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178673.3-2011s21c1
Sequence:CCGGACAGATCCTGTACCAGTTAAACTCGAGTTTAACTGGTACAGGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178673.3-2589s21c1
Sequence:CCGGCATCCACACCAACCTACATATCTCGAGATATGTAGGTTGGTGTGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)