EMAIL THIS PAGE TO A FRIEND

FTHL17

ferritin, heavy polypeptide-like 17

27 Gene Product Result for
Synonyms: CT38
UniProtKB ID: Q9BXU8, Q6NT24, Q6NTE2
Gene ID:
Human(53940) Summary: This gene is orthologous to a mouse gene that encodes a ferritin heavy polypeptide-like protein and shows testis-specific expression. [provided by RefSeq, Oct 2009]
Mouse(83457) ferritin, heavy polypeptide-like 17
cow(100300003) ferritin, heavy polypeptide-like 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031261 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031261 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031261 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031894 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055451 MISSION® esiRNA esiRNA human FTHL17 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031894 Rosetta Predictions human pricing
NM_031261 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042222 predicted 338
2 SASI_Hs01_00042223 predicted 331
3 SASI_Hs01_00042224 predicted 329
4 SASI_Hs01_00042225 predicted 243
5 SASI_Hs01_00042226 predicted 218
6 SASI_Hs01_00042227 predicted 503
7 SASI_Hs01_00042228 predicted 245
8 SASI_Hs01_00042229 predicted 341
9 SASI_Hs01_00042230 predicted 706
10 SASI_Hs01_00042231 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031261 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055117 predicted 159
2 SASI_Mm01_00055118 predicted 171
3 SASI_Mm01_00055115 predicted 229
4 SASI_Mm01_00055116 predicted 238
5 SASI_Mm01_00055119 predicted 794
6 SASI_Mm01_00055120 predicted 802
7 SASI_Mm01_00055121 predicted 805
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031261
FTHL17 MISSION shRNA Bacterial Glycerol Stock
ferritin, heavy polypeptide-like 17
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031261.2-672s21c1
Sequence:CCGGAGCCTGTCCTAAAGCTTCAAGCTCGAGCTTGAAGCTTTAGGACAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031261.2-437s21c1
Sequence:CCGGGGGATTTCAAGCCATGGAATGCTCGAGCATTCCATGGCTTGAAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031261.1-306s1c1
Sequence:CCGGCAAGCGTTTCTTCTTGACCAACTCGAGTTGGTCAAGAAGAAACGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031261.1-255s1c1
Sequence:CCGGCATGTCGATGGCAGTCTACTTCTCGAGAAGTAGACTGCCATCGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031261.1-265s1c1
Sequence:CCGGGCAGTCTACTTTGACCGTGATCTCGAGATCACGGTCAAAGTAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031261.1-465s1c1
Sequence:CCGGCCACATGGAGATGCTGATCAACTCGAGTTGATCAGCATCTCCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031261
FTHL17 MISSION shRNA shRNA Plasmid DNA
ferritin, heavy polypeptide-like 17
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031261.2-672s21c1
Sequence:CCGGAGCCTGTCCTAAAGCTTCAAGCTCGAGCTTGAAGCTTTAGGACAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031261.2-437s21c1
Sequence:CCGGGGGATTTCAAGCCATGGAATGCTCGAGCATTCCATGGCTTGAAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031261.1-306s1c1
Sequence:CCGGCAAGCGTTTCTTCTTGACCAACTCGAGTTGGTCAAGAAGAAACGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031261.1-255s1c1
Sequence:CCGGCATGTCGATGGCAGTCTACTTCTCGAGAAGTAGACTGCCATCGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031261.1-265s1c1
Sequence:CCGGGCAGTCTACTTTGACCGTGATCTCGAGATCACGGTCAAAGTAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031261.1-465s1c1
Sequence:CCGGCCACATGGAGATGCTGATCAACTCGAGTTGATCAGCATCTCCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031261
FTHL17 MISSION shRNA Lentiviral Transduction Particles
ferritin, heavy polypeptide-like 17
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031261.2-672s21c1
Sequence:CCGGAGCCTGTCCTAAAGCTTCAAGCTCGAGCTTGAAGCTTTAGGACAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031261.2-437s21c1
Sequence:CCGGGGGATTTCAAGCCATGGAATGCTCGAGCATTCCATGGCTTGAAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031261.1-306s1c1
Sequence:CCGGCAAGCGTTTCTTCTTGACCAACTCGAGTTGGTCAAGAAGAAACGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031261.1-255s1c1
Sequence:CCGGCATGTCGATGGCAGTCTACTTCTCGAGAAGTAGACTGCCATCGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031261.1-265s1c1
Sequence:CCGGGCAGTCTACTTTGACCGTGATCTCGAGATCACGGTCAAAGTAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031261.1-465s1c1
Sequence:CCGGCCACATGGAGATGCTGATCAACTCGAGTTGATCAGCATCTCCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031894
FTHL17 MISSION shRNA Bacterial Glycerol Stock
ferritin, heavy polypeptide-like 17
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031894.1-250s21c1
Sequence:CCGGGGAGAACTTCTTCCGCTACTTCTCGAGAAGTAGCGGAAGAAGTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031894.1-524s21c1
Sequence:CCGGGAGCAAGTCAAGACCATCAAACTCGAGTTTGATGGTCTTGACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031894.1-340s21c1
Sequence:CCGGCCACATCTGCCTTCACGATATCTCGAGATATCGTGAAGGCAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031894.1-603s21c1
Sequence:CCGGCTGAGTACCTGTTCGACAAGCCTCGAGGCTTGTCGAACAGGTACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031894.1-197s21c1
Sequence:CCGGTCCTACCTGTACCTGTCTATGCTCGAGCATAGACAGGTACAGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031894.1-208s1c1
Sequence:CCGGCCTGTCTATGGCCTTCTACTTCTCGAGAAGTAGAAGGCCATAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031894.1-340s1c1
Sequence:CCGGCCACATCTGCCTTCACGATATCTCGAGATATCGTGAAGGCAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031894.1-564s1c1
Sequence:CCGGGCAACCTGCGCAAGATTTGTTCTCGAGAACAAATCTTGCGCAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031894
FTHL17 MISSION shRNA shRNA Plasmid DNA
ferritin, heavy polypeptide-like 17
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031894.1-250s21c1
Sequence:CCGGGGAGAACTTCTTCCGCTACTTCTCGAGAAGTAGCGGAAGAAGTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031894.1-524s21c1
Sequence:CCGGGAGCAAGTCAAGACCATCAAACTCGAGTTTGATGGTCTTGACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031894.1-340s21c1
Sequence:CCGGCCACATCTGCCTTCACGATATCTCGAGATATCGTGAAGGCAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031894.1-603s21c1
Sequence:CCGGCTGAGTACCTGTTCGACAAGCCTCGAGGCTTGTCGAACAGGTACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031894.1-197s21c1
Sequence:CCGGTCCTACCTGTACCTGTCTATGCTCGAGCATAGACAGGTACAGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031894.1-208s1c1
Sequence:CCGGCCTGTCTATGGCCTTCTACTTCTCGAGAAGTAGAAGGCCATAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031894.1-340s1c1
Sequence:CCGGCCACATCTGCCTTCACGATATCTCGAGATATCGTGAAGGCAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031894.1-564s1c1
Sequence:CCGGGCAACCTGCGCAAGATTTGTTCTCGAGAACAAATCTTGCGCAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031894
FTHL17 MISSION shRNA Lentiviral Transduction Particles
ferritin, heavy polypeptide-like 17
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031894.1-250s21c1
Sequence:CCGGGGAGAACTTCTTCCGCTACTTCTCGAGAAGTAGCGGAAGAAGTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031894.1-524s21c1
Sequence:CCGGGAGCAAGTCAAGACCATCAAACTCGAGTTTGATGGTCTTGACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031894.1-340s21c1
Sequence:CCGGCCACATCTGCCTTCACGATATCTCGAGATATCGTGAAGGCAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031894.1-603s21c1
Sequence:CCGGCTGAGTACCTGTTCGACAAGCCTCGAGGCTTGTCGAACAGGTACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031894.1-197s21c1
Sequence:CCGGTCCTACCTGTACCTGTCTATGCTCGAGCATAGACAGGTACAGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031894.1-208s1c1
Sequence:CCGGCCTGTCTATGGCCTTCTACTTCTCGAGAAGTAGAAGGCCATAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031894.1-340s1c1
Sequence:CCGGCCACATCTGCCTTCACGATATCTCGAGATATCGTGAAGGCAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031894.1-564s1c1
Sequence:CCGGGCAACCTGCGCAAGATTTGTTCTCGAGAACAAATCTTGCGCAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks