EMAIL THIS PAGE TO A FRIEND

FTL

ferritin, light polypeptide

77 Gene Product Result for
Synonyms: NBIA3
Gene ID:
Human(2512) Summary: This gene encodes the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in this light chain ferritin gene are associated with several neurodegenerative diseases and hyperferritinemia-cataract syndrome. This gene has multiple pseudogenes. [provided by RefSeq, Jul 2008]
Rat(29292) ferritin, light polypeptide
sheep(101103834) ferritin, light polypeptide
Domestic Rabbit(100009254) ferritin, light polypeptide
naked mole-rat(101714614) ferritin, light polypeptide
domestic guinea pig(100379558) ferritin light chain 1
chicken(378899) ferritin, light polypeptide
domestic cat(654515) ferritin, light polypeptide
cow(286861) ferritin, light polypeptide
Horse(100051593) ferritin, light polypeptide
dog(477042) ferritin, light polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108636 Anti-FTL affinity isolated antibody rat, horse, mouse, rabbit, pig, guinea pig, bovine, sheep, canine, human
western blot pricing
F8556 Anti-FTL (86-120) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2500431 Anti-FTL antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing
SAB1409055 Anti-FTL antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AV54292 Anti-FTL antibody produced in rabbit affinity isolated antibody pig, sheep, human, guinea pig, horse, rabbit, mouse, rabbit, bovine, rat, canine
western blot pricing
HPA041602 Anti-FTL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1410460 Anti-FTL antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, western blot pricing
SAB4200616 Monoclonal Anti-FTL antibody from mouse clone FTL1.1, purified immunoglobulin human
flow cytometry, immunofluorescence, western blot pricing
SAB1409043 Monoclonal Anti-FTL antibody produced in mouse clone 3E8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409044 Monoclonal Anti-FTL antibody produced in mouse clone 1E7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409045 Monoclonal Anti-FTL antibody produced in mouse clone 1C2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409046 Monoclonal Anti-FTL antibody produced in mouse clone 3E12, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409047 Monoclonal Anti-FTL antibody produced in mouse clone 2C3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409048 Monoclonal Anti-FTL antibody produced in mouse clone 4A7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409049 Monoclonal Anti-FTL antibody produced in mouse clone 4G9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409050 Monoclonal Anti-FTL antibody produced in mouse clone 4G10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409051 Monoclonal Anti-FTL antibody produced in mouse clone 4D11, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409052 Monoclonal Anti-FTL antibody produced in mouse clone 4C10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409053 Monoclonal Anti-FTL antibody produced in mouse clone 3B2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409054 Monoclonal Anti-FTL antibody produced in mouse clone X1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409056 Monoclonal Anti-FTL antibody produced in mouse clone X3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403841 Monoclonal Anti-FTL Native pur antibody produced in mouse clone 4G7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000146 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000146 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000146 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111441 MISSION® esiRNA esiRNA human FTL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000146 Rosetta Predictions human pricing
NM_022500 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301961 predicted 325
2 SASI_Hs01_00098594 predicted 243
3 SASI_Hs01_00098595 predicted 245
4 SASI_Hs01_00098586 predicted 296
5 SASI_Hs01_00098587 predicted 380
6 SASI_Hs01_00098588 predicted 569
7 SASI_Hs01_00098590 predicted 202
8 SASI_Hs01_00098591 predicted 336
9 SASI_Hs01_00098593 predicted 583
10 SASI_Hs02_00301962 predicted 284
11 SASI_Hs01_00098589 predicted 213
12 SASI_Hs01_00098592 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263197 predicted 279
2 SASI_Rn02_00263198 predicted 347
3 SASI_Rn02_00263199 predicted 332
4 SASI_Rn02_00263200 predicted 215
5 SASI_Rn02_00263201 predicted 360
6 SASI_Rn02_00263202 predicted 597
7 SASI_Rn02_00263203 predicted 252
8 SASI_Rn02_00263204 predicted 213
9 SASI_Rn02_00263205 predicted 217
10 SASI_Rn02_00263206 predicted 297
11 SASI_Rn01_00115265 predicted 846
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000146
VALIDATED
FTL MISSION shRNA Bacterial Glycerol Stock
ferritin, light polypeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000146.2-576s1c1
Sequence:CCGGCTGGAGACTCACTTCCTAGATCTCGAGATCTAGGAAGTGAGTCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000146.2-695s1c1
Sequence:CCGGGCTCACTCTCAAGCACGACTACTCGAGTAGTCGTGCTTGAGAGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000146.2-245s1c1
Sequence:CCGGCCTGGTCAATTTGTACCTGCACTCGAGTGCAGGTACAAATTGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000146.2-429s1c1
Sequence:CCGGGACATCAAGAAGCCAGCTGAACTCGAGTTCAGCTGGCTTCTTGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000146.2-306s1c1
Sequence:CCGGCGCGATGATGTGGCTCTGGAACTCGAGTTCCAGAGCCACATCATCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000146.3-344s21c1
Sequence:CCGGAGCCACTTCTTCCGCGAATTGCTCGAGCAATTCGCGGAAGAAGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000146.3-609s21c1
Sequence:CCGGAGGAAGTGAAGCTTATCAAGACTCGAGTCTTGATAAGCTTCACTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000146.3-291s21c1
Sequence:CCGGACCTCTCTCTGGGCTTCTATTCTCGAGAATAGAAGCCCAGAGAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000146.3-732s21c1
Sequence:CCGGCTTCTGAGCCCAGCGACTTCTCTCGAGAGAAGTCGCTGGGCTCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000146
VALIDATED
FTL MISSION shRNA shRNA Plasmid DNA
ferritin, light polypeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000146.2-576s1c1
Sequence:CCGGCTGGAGACTCACTTCCTAGATCTCGAGATCTAGGAAGTGAGTCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000146.2-695s1c1
Sequence:CCGGGCTCACTCTCAAGCACGACTACTCGAGTAGTCGTGCTTGAGAGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000146.2-245s1c1
Sequence:CCGGCCTGGTCAATTTGTACCTGCACTCGAGTGCAGGTACAAATTGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000146.2-429s1c1
Sequence:CCGGGACATCAAGAAGCCAGCTGAACTCGAGTTCAGCTGGCTTCTTGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000146.2-306s1c1
Sequence:CCGGCGCGATGATGTGGCTCTGGAACTCGAGTTCCAGAGCCACATCATCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000146.3-344s21c1
Sequence:CCGGAGCCACTTCTTCCGCGAATTGCTCGAGCAATTCGCGGAAGAAGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000146.3-609s21c1
Sequence:CCGGAGGAAGTGAAGCTTATCAAGACTCGAGTCTTGATAAGCTTCACTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000146.3-291s21c1
Sequence:CCGGACCTCTCTCTGGGCTTCTATTCTCGAGAATAGAAGCCCAGAGAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000146.3-732s21c1
Sequence:CCGGCTTCTGAGCCCAGCGACTTCTCTCGAGAGAAGTCGCTGGGCTCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000146
VALIDATED
FTL MISSION shRNA Lentiviral Transduction Particles
ferritin, light polypeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000146.2-576s1c1
Sequence:CCGGCTGGAGACTCACTTCCTAGATCTCGAGATCTAGGAAGTGAGTCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000146.2-695s1c1
Sequence:CCGGGCTCACTCTCAAGCACGACTACTCGAGTAGTCGTGCTTGAGAGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000146.2-245s1c1
Sequence:CCGGCCTGGTCAATTTGTACCTGCACTCGAGTGCAGGTACAAATTGACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000146.2-429s1c1
Sequence:CCGGGACATCAAGAAGCCAGCTGAACTCGAGTTCAGCTGGCTTCTTGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000146.2-306s1c1
Sequence:CCGGCGCGATGATGTGGCTCTGGAACTCGAGTTCCAGAGCCACATCATCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000146.3-344s21c1
Sequence:CCGGAGCCACTTCTTCCGCGAATTGCTCGAGCAATTCGCGGAAGAAGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000146.3-609s21c1
Sequence:CCGGAGGAAGTGAAGCTTATCAAGACTCGAGTCTTGATAAGCTTCACTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000146.3-291s21c1
Sequence:CCGGACCTCTCTCTGGGCTTCTATTCTCGAGAATAGAAGCCCAGAGAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000146.3-732s21c1
Sequence:CCGGCTTCTGAGCCCAGCGACTTCTCTCGAGAGAAGTCGCTGGGCTCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks