EMAIL THIS PAGE TO A FRIEND

FTMT

ferritin mitochondrial

42 Gene Product Result for
Synonyms: MTF
UniProtKB ID: Q8N4E7
Gene ID:
Mouse(67634) ferritin mitochondrial
Rat(291470) ferritin mitochondrial
sheep(101112726) ferritin mitochondrial
domestic guinea pig(100721010) ferritin mitochondrial
cow(539838) ferritin mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
F6754 Ferritin from human liver Type IV, 10 μg/mL human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177478 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026286 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026286 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026286 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152541 MISSION® esiRNA esiRNA human FTMT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177478 Rosetta Predictions human pricing
NM_001106136 Rosetta Predictions rat pricing
NM_026286 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134859 predicted 590
2 SASI_Hs01_00134862 predicted 538
3 SASI_Hs01_00134863 predicted 269
4 SASI_Hs01_00134864 predicted 484
5 SASI_Hs01_00134865 predicted 313
6 SASI_Hs01_00134866 predicted 485
7 SASI_Hs02_00369356 predicted 322
8 SASI_Hs01_00134867 predicted 295
9 SASI_Hs01_00134868 predicted 297
10 SASI_Hs02_00369357 predicted 272
11 SASI_Hs01_00134860 predicted 340
12 SASI_Hs01_00134861 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215978 predicted 611
2 SASI_Rn02_00215979 predicted 661
3 SASI_Rn02_00215980 predicted 440
4 SASI_Rn02_00215981 predicted 776
5 SASI_Rn02_00215982 predicted 325
6 SASI_Rn02_00215983 predicted 334
7 SASI_Rn02_00215984 predicted 660
8 SASI_Rn02_00215985 predicted 501
9 SASI_Rn02_00215986 predicted 477
10 SASI_Rn02_00215987 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026286 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149950 predicted 295
2 SASI_Mm01_00149951 predicted 429
3 SASI_Mm01_00149952 predicted 642
4 SASI_Mm01_00149953 predicted 1024
5 SASI_Mm01_00149954 predicted 495
6 SASI_Mm01_00149955 predicted 306
7 SASI_Mm01_00149956 predicted 506
8 SASI_Mm01_00149957 predicted 382
9 SASI_Mm01_00149958 predicted 589
10 SASI_Mm01_00149959 predicted 397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177478
FTMT MISSION shRNA Bacterial Glycerol Stock
ferritin mitochondrial
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177478.1-613s1c1
Sequence:CCGGGTGAAGTCTATCAAAGAACTACTCGAGTAGTTCTTTGATAGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177478.1-642s1c1
Sequence:CCGGCGTGCACAACTTAGTGAAGATCTCGAGATCTTCACTAAGTTGTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177478.1-585s1c1
Sequence:CCGGCCTGGAAACCTACTACCTGAACTCGAGTTCAGGTAGTAGGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177478.1-609s1c1
Sequence:CCGGGCAGGTGAAGTCTATCAAAGACTCGAGTCTTTGATAGACTTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177478.1-610s1c1
Sequence:CCGGCAGGTGAAGTCTATCAAAGAACTCGAGTTCTTTGATAGACTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177478.1-542s21c1
Sequence:CCGGACGCTCTAGCCTCAGATAAAGCTCGAGCTTTATCTGAGGCTAGAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177478.1-289s21c1
Sequence:CCGGTACTTGTCCATGGCCTATTACCTCGAGGTAATAGGCCATGGACAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177478.1-513s21c1
Sequence:CCGGGAACGTGAACCAGTCGTTGCTCTCGAGAGCAACGACTGGTTCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177478
FTMT MISSION shRNA shRNA Plasmid DNA
ferritin mitochondrial
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177478.1-613s1c1
Sequence:CCGGGTGAAGTCTATCAAAGAACTACTCGAGTAGTTCTTTGATAGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177478.1-642s1c1
Sequence:CCGGCGTGCACAACTTAGTGAAGATCTCGAGATCTTCACTAAGTTGTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177478.1-585s1c1
Sequence:CCGGCCTGGAAACCTACTACCTGAACTCGAGTTCAGGTAGTAGGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177478.1-609s1c1
Sequence:CCGGGCAGGTGAAGTCTATCAAAGACTCGAGTCTTTGATAGACTTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177478.1-610s1c1
Sequence:CCGGCAGGTGAAGTCTATCAAAGAACTCGAGTTCTTTGATAGACTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177478.1-542s21c1
Sequence:CCGGACGCTCTAGCCTCAGATAAAGCTCGAGCTTTATCTGAGGCTAGAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177478.1-289s21c1
Sequence:CCGGTACTTGTCCATGGCCTATTACCTCGAGGTAATAGGCCATGGACAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177478.1-513s21c1
Sequence:CCGGGAACGTGAACCAGTCGTTGCTCTCGAGAGCAACGACTGGTTCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177478
FTMT MISSION shRNA Lentiviral Transduction Particles
ferritin mitochondrial
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177478.1-613s1c1
Sequence:CCGGGTGAAGTCTATCAAAGAACTACTCGAGTAGTTCTTTGATAGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177478.1-642s1c1
Sequence:CCGGCGTGCACAACTTAGTGAAGATCTCGAGATCTTCACTAAGTTGTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177478.1-585s1c1
Sequence:CCGGCCTGGAAACCTACTACCTGAACTCGAGTTCAGGTAGTAGGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177478.1-609s1c1
Sequence:CCGGGCAGGTGAAGTCTATCAAAGACTCGAGTCTTTGATAGACTTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177478.1-610s1c1
Sequence:CCGGCAGGTGAAGTCTATCAAAGAACTCGAGTTCTTTGATAGACTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177478.1-542s21c1
Sequence:CCGGACGCTCTAGCCTCAGATAAAGCTCGAGCTTTATCTGAGGCTAGAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177478.1-289s21c1
Sequence:CCGGTACTTGTCCATGGCCTATTACCTCGAGGTAATAGGCCATGGACAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177478.1-513s21c1
Sequence:CCGGGAACGTGAACCAGTCGTTGCTCTCGAGAGCAACGACTGGTTCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026286
FTMT MISSION shRNA Bacterial Glycerol Stock
ferritin mitochondrial
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026286.1-963s1c1
Sequence:CCGGCGGCTTTCTACCAACACCAAACTCGAGTTTGGTGTTGGTAGAAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026286.1-328s1c1
Sequence:CCGGGCTTTACGCATCCTACGTGTACTCGAGTACACGTAGGATGCGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026286.1-138s1c1
Sequence:CCGGCCCGTGTGTTACACAGATTCACTCGAGTGAATCTGTGTAACACACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026286.1-665s1c1
Sequence:CCGGGAGCAAGTGAAGTCTATCAAACTCGAGTTTGATAGACTTCACTTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026286.1-509s1c1
Sequence:CCGGCCAGATAAAGATGACTGGGAACTCGAGTTCCCAGTCATCTTTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026286.3-1107s21c1
Sequence:CCGGTCCATAAACCTGAACTGAAATCTCGAGATTTCAGTTCAGGTTTATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026286.3-390s21c1
Sequence:CCGGGTATAACTTCTCCAAGTATTTCTCGAGAAATACTTGGAGAAGTTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026286.3-1215s21c1
Sequence:CCGGTGTAAGACAGAGAAGATATAGCTCGAGCTATATCTTCTCTGTCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026286.3-436s21c1
Sequence:CCGGGAACATGCAGAGAAGCTAATGCTCGAGCATTAGCTTCTCTGCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026286
FTMT MISSION shRNA shRNA Plasmid DNA
ferritin mitochondrial
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026286.1-963s1c1
Sequence:CCGGCGGCTTTCTACCAACACCAAACTCGAGTTTGGTGTTGGTAGAAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026286.1-328s1c1
Sequence:CCGGGCTTTACGCATCCTACGTGTACTCGAGTACACGTAGGATGCGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026286.1-138s1c1
Sequence:CCGGCCCGTGTGTTACACAGATTCACTCGAGTGAATCTGTGTAACACACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026286.1-665s1c1
Sequence:CCGGGAGCAAGTGAAGTCTATCAAACTCGAGTTTGATAGACTTCACTTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026286.1-509s1c1
Sequence:CCGGCCAGATAAAGATGACTGGGAACTCGAGTTCCCAGTCATCTTTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026286.3-1107s21c1
Sequence:CCGGTCCATAAACCTGAACTGAAATCTCGAGATTTCAGTTCAGGTTTATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026286.3-390s21c1
Sequence:CCGGGTATAACTTCTCCAAGTATTTCTCGAGAAATACTTGGAGAAGTTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026286.3-1215s21c1
Sequence:CCGGTGTAAGACAGAGAAGATATAGCTCGAGCTATATCTTCTCTGTCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026286.3-436s21c1
Sequence:CCGGGAACATGCAGAGAAGCTAATGCTCGAGCATTAGCTTCTCTGCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026286
FTMT MISSION shRNA Lentiviral Transduction Particles
ferritin mitochondrial
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026286.1-963s1c1
Sequence:CCGGCGGCTTTCTACCAACACCAAACTCGAGTTTGGTGTTGGTAGAAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026286.1-328s1c1
Sequence:CCGGGCTTTACGCATCCTACGTGTACTCGAGTACACGTAGGATGCGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026286.1-138s1c1
Sequence:CCGGCCCGTGTGTTACACAGATTCACTCGAGTGAATCTGTGTAACACACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026286.1-665s1c1
Sequence:CCGGGAGCAAGTGAAGTCTATCAAACTCGAGTTTGATAGACTTCACTTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026286.1-509s1c1
Sequence:CCGGCCAGATAAAGATGACTGGGAACTCGAGTTCCCAGTCATCTTTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026286.3-1107s21c1
Sequence:CCGGTCCATAAACCTGAACTGAAATCTCGAGATTTCAGTTCAGGTTTATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026286.3-390s21c1
Sequence:CCGGGTATAACTTCTCCAAGTATTTCTCGAGAAATACTTGGAGAAGTTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026286.3-1215s21c1
Sequence:CCGGTGTAAGACAGAGAAGATATAGCTCGAGCTATATCTTCTCTGTCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026286.3-436s21c1
Sequence:CCGGGAACATGCAGAGAAGCTAATGCTCGAGCATTAGCTTCTCTGCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks