EMAIL THIS PAGE TO A FRIEND

FTO

fat mass and obesity associated

181 Gene Product Result for
Synonyms: ALKBH9
UniProtKB ID: Q9C0B1, A2RUH1, B2RNS0, Q0P676, Q7Z785
Gene ID:
Human(79068) Summary: This gene is a nuclear protein of the AlkB related non-haem iron and 2-oxoglutarate-dependent oxygenase superfamily but the exact physiological function of this gene is not known. Other non-heme iron enzymes function to reverse alkylated DNA and RNA damage by oxidative demethylation. Studies in mice and humans indicate a role in nervous and cardiovascular systems and a strong association with body mass index, obesity risk, and type 2 diabetes. [provided by RefSeq, Jul 2011]
Mouse(26383) fat mass and obesity associated
Rat(291905) fat mass and obesity associated
Zebrafish(553363) fat mass and obesity associated
cow(618622) fat mass and obesity associated
Horse(100060565) fat mass and obesity associated
domestic cat(101098594) fat mass and obesity associated
dog(478125) fat mass and obesity associated
chicken(415718) fat mass and obesity associated
domestic guinea pig(100730858) fat mass and obesity associated
naked mole-rat(101700280) fat mass and obesity associated
sheep(100125353) fat mass and obesity associated
Domestic Rabbit(100301537) fat mass and obesity associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011936 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011936 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011936 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080432 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080432 Rosetta Predictions human pricing
XM_051200 Rosetta Predictions human pricing
XM_931743 Rosetta Predictions human pricing
XM_931747 Rosetta Predictions human pricing
XM_931752 Rosetta Predictions human pricing
NM_001039713 Rosetta Predictions rat pricing
NM_011936 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314786 predicted 1269
2 SASI_Hs02_00314787 predicted 863
3 SASI_Hs02_00314788 predicted 1789
4 SASI_Hs02_00314789 predicted 1366
5 SASI_Hs02_00314790 predicted 359
6 SASI_Hs02_00314791 predicted 641
7 SASI_Hs02_00314792 predicted 457
8 SASI_Hs02_00314793 predicted 1675
9 SASI_Hs02_00314794 predicted 680
10 SASI_Hs02_00314795 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_051200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277733 predicted 681
2 SASI_Hs01_00277734 predicted 1605
3 SASI_Hs01_00277735 predicted 1186
4 SASI_Hs01_00277736 predicted 595
5 SASI_Hs01_00277737 predicted 85
6 SASI_Hs01_00277738 predicted 465
7 SASI_Hs01_00277739 predicted 276
8 SASI_Hs01_00277740 predicted 1495
9 SASI_Hs01_00277741 predicted 359
10 SASI_Hs01_00277742 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256958 predicted 81
2 SASI_Hs01_00256959 predicted 427
3 SASI_Hs01_00256960 predicted 300
4 SASI_Hs01_00256961 predicted 94
5 SASI_Hs01_00256962 predicted 291
6 SASI_Hs01_00256963 predicted 634
7 SASI_Hs01_00256964 predicted 189
8 SASI_Hs01_00256965 predicted 384
9 SASI_Hs01_00256966 predicted 166
10 SASI_Hs01_00256967 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295959 predicted 686
2 SASI_Hs01_00295960 predicted 560
3 SASI_Hs01_00295961 predicted 143
4 SASI_Hs01_00295962 predicted 180
5 SASI_Hs01_00295963 predicted 885
6 SASI_Hs01_00295964 predicted 438
7 SASI_Hs01_00295965 predicted 632
8 SASI_Hs01_00295966 predicted 157
9 SASI_Hs01_00295967 predicted 421
10 SASI_Hs01_00295968 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252201 predicted 655
2 SASI_Hs01_00252202 predicted 536
3 SASI_Hs01_00252203 predicted 860
4 SASI_Hs01_00252204 predicted 420
5 SASI_Hs01_00252205 predicted 608
6 SASI_Hs01_00252206 predicted 339
7 SASI_Hs01_00252207 predicted 399
8 SASI_Hs01_00252208 predicted 264
9 SASI_Hs01_00252209 predicted 851
10 SASI_Hs01_00252210 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039713 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076508 predicted 1125
2 SASI_Rn01_00076509 predicted 791
3 SASI_Rn01_00076510 predicted 975
4 SASI_Rn01_00076512 predicted 353
5 SASI_Rn01_00076513 predicted 1137
6 SASI_Rn01_00076514 predicted 582
7 SASI_Rn01_00076515 predicted 415
8 SASI_Rn01_00076516 predicted 1230
9 SASI_Rn01_00076517 predicted 454
10 SASI_Rn02_00204883 predicted 966
11 SASI_Rn01_00076511 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011936 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076831 predicted 634
2 SASI_Mm01_00076834 predicted 1197
3 SASI_Mm01_00076832 predicted 1537
4 SASI_Mm01_00076833 predicted 665
5 SASI_Mm01_00076835 predicted 1551
6 SASI_Mm02_00321779 predicted 1180
7 SASI_Mm02_00321780 predicted 1025
8 SASI_Mm01_00076836 predicted 1281
9 SASI_Mm01_00076840 predicted 641
10 SASI_Mm02_00321781 predicted 1639
11 SASI_Mm01_00076837 predicted 1642
12 SASI_Mm01_00076838 predicted 1168
13 SASI_Mm01_00076839 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011936
VALIDATED
FTO MISSION shRNA Bacterial Glycerol Stock
fat mass and obesity associated
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011936.2-912s21c1
Sequence:CCGGCCAGGGAGACTGCTATTTCATCTCGAGATGAAATAGCAGTCTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216341    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011936.2-2104s1c1
Sequence:CCGGGACGACACATACAGATGTTTACTCGAGTAAACATCTGTATGTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011936.2-604s1c1
Sequence:CCGGGATGATGAAGTGGACCTTAAGCTCGAGCTTAAGGTCCACTTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011936.2-1102s21c1
Sequence:CCGGGTCTCGTTGAAATCCTTTGATCTCGAGATCAAAGGATTTCAACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011936.2-1738s21c1
Sequence:CCGGTAGTCTGACTTGGTGTTAAATCTCGAGATTTAACACCAAGTCAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011936.2-685s21c1
Sequence:CCGGTTGAAAGAGGAGCCCTATTTCCTCGAGGAAATAGGGCTCCTCTTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011936.1-898s1c1
Sequence:CCGGCCAGGGAGACTGCTATTTCATCTCGAGATGAAATAGCAGTCTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011936.1-1088s1c1
Sequence:CCGGGTCTCGTTGAAATCCTTTGATCTCGAGATCAAAGGATTTCAACGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011936.1-625s1c1
Sequence:CCGGCAACGTGACTTTGCTAAACTTCTCGAGAAGTTTAGCAAAGTCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011936.1-1190s1c1
Sequence:CCGGCGATACAAACTTTGCACCGATCTCGAGATCGGTGCAAAGTTTGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011936.1-1685s1c1
Sequence:CCGGGCCCACAGATTCTGAAGTGTTCTCGAGAACACTTCAGAATCTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011936.1-863s1c1
Sequence:CCGGGACATCGAGACACCAGGATTACTCGAGTAATCCTGGTGTCTCGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011936
VALIDATED
FTO MISSION shRNA shRNA Plasmid DNA
fat mass and obesity associated
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011936.2-912s21c1
Sequence:CCGGCCAGGGAGACTGCTATTTCATCTCGAGATGAAATAGCAGTCTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216341    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011936.2-2104s1c1
Sequence:CCGGGACGACACATACAGATGTTTACTCGAGTAAACATCTGTATGTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011936.2-604s1c1
Sequence:CCGGGATGATGAAGTGGACCTTAAGCTCGAGCTTAAGGTCCACTTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011936.2-1102s21c1
Sequence:CCGGGTCTCGTTGAAATCCTTTGATCTCGAGATCAAAGGATTTCAACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011936.2-1738s21c1
Sequence:CCGGTAGTCTGACTTGGTGTTAAATCTCGAGATTTAACACCAAGTCAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011936.2-685s21c1
Sequence:CCGGTTGAAAGAGGAGCCCTATTTCCTCGAGGAAATAGGGCTCCTCTTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011936.1-898s1c1
Sequence:CCGGCCAGGGAGACTGCTATTTCATCTCGAGATGAAATAGCAGTCTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011936.1-1088s1c1
Sequence:CCGGGTCTCGTTGAAATCCTTTGATCTCGAGATCAAAGGATTTCAACGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011936.1-625s1c1
Sequence:CCGGCAACGTGACTTTGCTAAACTTCTCGAGAAGTTTAGCAAAGTCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011936.1-1190s1c1
Sequence:CCGGCGATACAAACTTTGCACCGATCTCGAGATCGGTGCAAAGTTTGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011936.1-1685s1c1
Sequence:CCGGGCCCACAGATTCTGAAGTGTTCTCGAGAACACTTCAGAATCTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011936.1-863s1c1
Sequence:CCGGGACATCGAGACACCAGGATTACTCGAGTAATCCTGGTGTCTCGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011936
VALIDATED
FTO MISSION shRNA Lentiviral Transduction Particles
fat mass and obesity associated
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011936.2-912s21c1
Sequence:CCGGCCAGGGAGACTGCTATTTCATCTCGAGATGAAATAGCAGTCTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216341    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011936.2-2104s1c1
Sequence:CCGGGACGACACATACAGATGTTTACTCGAGTAAACATCTGTATGTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011936.2-604s1c1
Sequence:CCGGGATGATGAAGTGGACCTTAAGCTCGAGCTTAAGGTCCACTTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011936.2-1102s21c1
Sequence:CCGGGTCTCGTTGAAATCCTTTGATCTCGAGATCAAAGGATTTCAACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011936.2-1738s21c1
Sequence:CCGGTAGTCTGACTTGGTGTTAAATCTCGAGATTTAACACCAAGTCAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011936.2-685s21c1
Sequence:CCGGTTGAAAGAGGAGCCCTATTTCCTCGAGGAAATAGGGCTCCTCTTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011936.1-898s1c1
Sequence:CCGGCCAGGGAGACTGCTATTTCATCTCGAGATGAAATAGCAGTCTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011936.1-1088s1c1
Sequence:CCGGGTCTCGTTGAAATCCTTTGATCTCGAGATCAAAGGATTTCAACGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011936.1-625s1c1
Sequence:CCGGCAACGTGACTTTGCTAAACTTCTCGAGAAGTTTAGCAAAGTCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011936.1-1190s1c1
Sequence:CCGGCGATACAAACTTTGCACCGATCTCGAGATCGGTGCAAAGTTTGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011936.1-1685s1c1
Sequence:CCGGGCCCACAGATTCTGAAGTGTTCTCGAGAACACTTCAGAATCTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011936.1-863s1c1
Sequence:CCGGGACATCGAGACACCAGGATTACTCGAGTAATCCTGGTGTCTCGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080432
VALIDATED
FTO MISSION shRNA Bacterial Glycerol Stock
fat mass and obesity associated
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-545s21c1
Sequence:CCGGACCTGAACACCAGGCTCTTTACTCGAGTAAAGAGCCTGGTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-3985s21c1
Sequence:CCGGTCGCATGGCAGCAAGCTAAATCTCGAGATTTAGCTTGCTGCCATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-1089s21c1
Sequence:CCGGTCACCAAGGAGACTGCTATTTCTCGAGAAATAGCAGTCTCCTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-1155s21c1
Sequence:CCGGCGGTTCACAACCTCGGTTTAGCTCGAGCTAAACCGAGGTTGTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-3561s21c1
Sequence:CCGGCCCATTAGGTGCCCATATTTACTCGAGTAAATATGGGCACCTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-1594s21c1
Sequence:CCGGTCACGAATTGCCCGAACATTACTCGAGTAATGTTCGGGCAATTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-505s21c1
Sequence:CCGGTCTCGCATCCTCATTGGTAATCTCGAGATTACCAATGAGGATGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-819s21c1
Sequence:CCGGCAACGTAACTTTGCTGAATTTCTCGAGAAATTCAGCAAAGTTACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-576s21c1
Sequence:CCGGGCCAGTGAAAGGGTCTAATATCTCGAGATATTAGACCCTTTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080432
VALIDATED
FTO MISSION shRNA shRNA Plasmid DNA
fat mass and obesity associated
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-545s21c1
Sequence:CCGGACCTGAACACCAGGCTCTTTACTCGAGTAAAGAGCCTGGTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-3985s21c1
Sequence:CCGGTCGCATGGCAGCAAGCTAAATCTCGAGATTTAGCTTGCTGCCATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-1089s21c1
Sequence:CCGGTCACCAAGGAGACTGCTATTTCTCGAGAAATAGCAGTCTCCTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-1155s21c1
Sequence:CCGGCGGTTCACAACCTCGGTTTAGCTCGAGCTAAACCGAGGTTGTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-3561s21c1
Sequence:CCGGCCCATTAGGTGCCCATATTTACTCGAGTAAATATGGGCACCTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-1594s21c1
Sequence:CCGGTCACGAATTGCCCGAACATTACTCGAGTAATGTTCGGGCAATTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-505s21c1
Sequence:CCGGTCTCGCATCCTCATTGGTAATCTCGAGATTACCAATGAGGATGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-819s21c1
Sequence:CCGGCAACGTAACTTTGCTGAATTTCTCGAGAAATTCAGCAAAGTTACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-576s21c1
Sequence:CCGGGCCAGTGAAAGGGTCTAATATCTCGAGATATTAGACCCTTTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080432
VALIDATED
FTO MISSION shRNA Lentiviral Transduction Particles
fat mass and obesity associated
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-545s21c1
Sequence:CCGGACCTGAACACCAGGCTCTTTACTCGAGTAAAGAGCCTGGTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-3985s21c1
Sequence:CCGGTCGCATGGCAGCAAGCTAAATCTCGAGATTTAGCTTGCTGCCATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-1089s21c1
Sequence:CCGGTCACCAAGGAGACTGCTATTTCTCGAGAAATAGCAGTCTCCTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-1155s21c1
Sequence:CCGGCGGTTCACAACCTCGGTTTAGCTCGAGCTAAACCGAGGTTGTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-3561s21c1
Sequence:CCGGCCCATTAGGTGCCCATATTTACTCGAGTAAATATGGGCACCTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-1594s21c1
Sequence:CCGGTCACGAATTGCCCGAACATTACTCGAGTAATGTTCGGGCAATTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-505s21c1
Sequence:CCGGTCTCGCATCCTCATTGGTAATCTCGAGATTACCAATGAGGATGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-819s21c1
Sequence:CCGGCAACGTAACTTTGCTGAATTTCTCGAGAAATTCAGCAAAGTTACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080432.1-576s21c1
Sequence:CCGGGCCAGTGAAAGGGTCTAATATCTCGAGATATTAGACCCTTTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks