EMAIL THIS PAGE TO A FRIEND

FTSJ2

FtsJ RNA methyltransferase homolog 2 (E. coli)

50 Gene Product Result for
Synonyms: FJH1 MRM2
UniProtKB ID: Q9UI43, Q24JR8
Gene ID:
Human(29960) Summary: The protein encoded by this gene is a member of the S-adenosylmethionine-binding protein family. It is a nucleolar protein and it may be involved in the processing and modification of rRNA. This gene has been suggested to be involved in cell cycle control and DNA repair. [provided by RefSeq, Jul 2008]
Mouse(68017) FtsJ homolog 2 (E. coli)
Rat(304323) FtsJ RNA methyltransferase homolog 2 (E. coli)
domestic guinea pig(100731196) FtsJ RNA methyltransferase homolog 2 (E. coli)
naked mole-rat(101711976) FtsJ RNA methyltransferase homolog 2 (E. coli)
sheep(101119526) FtsJ RNA methyltransferase homolog 2 (E. coli)
Zebrafish(326997) FtsJ homolog 2 (E. coli)
cow(790010) FtsJ RNA methyltransferase homolog 2 (E. coli)
domestic cat(101090822) FtsJ RNA methyltransferase homolog 2 (E. coli)
dog(100684914) FtsJ RNA methyltransferase homolog 2 (E. coli)
chicken(416466) FtsJ RNA methyltransferase homolog 2 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013393 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU055811 MISSION® esiRNA esiRNA targeting mouse Ftsj2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013393 Rosetta Predictions human pricing
NM_001107125 Rosetta Predictions rat pricing
NM_026510 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122299 predicted 325
2 SASI_Hs01_00122300 predicted 634
3 SASI_Hs01_00122303 predicted 645
4 SASI_Hs01_00122304 predicted 470
5 SASI_Hs02_00344758 predicted 647
6 SASI_Hs01_00122305 predicted 486
7 SASI_Hs01_00122307 predicted 300
8 SASI_Hs02_00344759 predicted 519
9 SASI_Hs02_00344760 predicted 283
10 SASI_Hs02_00344761 predicted 212
11 SASI_Hs01_00122298 predicted 669
12 SASI_Hs01_00122301 predicted 658
13 SASI_Hs01_00122302 predicted 539
14 SASI_Hs01_00122306 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225746 predicted 556
2 SASI_Rn02_00225747 predicted 480
3 SASI_Rn02_00225748 predicted 532
4 SASI_Rn02_00225749 predicted 384
5 SASI_Rn02_00225750 predicted 512
6 SASI_Rn02_00225751 predicted 571
7 SASI_Rn02_00225752 predicted 540
8 SASI_Rn02_00225753 predicted 294
9 SASI_Rn02_00225754 predicted 553
10 SASI_Rn02_00225755 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032863 predicted 384
2 SASI_Mm01_00032864 predicted 518
3 SASI_Mm01_00032865 predicted 475
4 SASI_Mm01_00032866 predicted 1192
5 SASI_Mm01_00032867 predicted 648
6 SASI_Mm01_00032868 predicted 674
7 SASI_Mm01_00032869 predicted 336
8 SASI_Mm01_00032871 predicted 1030
9 SASI_Mm01_00032872 predicted 719
10 SASI_Mm02_00330416 predicted 362
11 SASI_Mm01_00032870 predicted 557
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013393
VALIDATED
FTSJ2 MISSION shRNA Bacterial Glycerol Stock
FtsJ RNA methyltransferase homolog 2 (E. coli)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013393.1-1112s21c1
Sequence:CCGGTTGACGGGACTTCATCTTATACTCGAGTATAAGATGAAGTCCCGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013393.1-217s21c1
Sequence:CCGGTGAACGAGAGGCACCAGATTCCTCGAGGAATCTGGTGCCTCTCGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013393.1-644s21c1
Sequence:CCGGGAGGAGACTGACAGAGGAATTCTCGAGAATTCCTCTGTCAGTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013393.1-701s21c1
Sequence:CCGGGAAAGAGTCATCAGAAGTGTACTCGAGTACACTTCTGATGACTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013393.1-359s21c1
Sequence:CCGGGGTAGATCTTCTTCACATATTCTCGAGAATATGTGAAGAAGATCTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_013393.1-665s1c1
Sequence:CCGGCCAGAATGTAAGGATCATCAACTCGAGTTGATGATCCTTACATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013393.1-137s1c1
Sequence:CCGGCCGACATCTCAGGGACCCATTCTCGAGAATGGGTCCCTGAGATGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_013393.1-425s1c1
Sequence:CCGGCCCGAGAACCTCACAGAGAATCTCGAGATTCTCTGTGAGGTTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_013393.1-701s1c1
Sequence:CCGGGAAAGAGTCATCAGAAGTGTACTCGAGTACACTTCTGATGACTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013393.1-644s1c1
Sequence:CCGGGAGGAGACTGACAGAGGAATTCTCGAGAATTCCTCTGTCAGTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013393
VALIDATED
FTSJ2 MISSION shRNA shRNA Plasmid DNA
FtsJ RNA methyltransferase homolog 2 (E. coli)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013393.1-1112s21c1
Sequence:CCGGTTGACGGGACTTCATCTTATACTCGAGTATAAGATGAAGTCCCGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013393.1-217s21c1
Sequence:CCGGTGAACGAGAGGCACCAGATTCCTCGAGGAATCTGGTGCCTCTCGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013393.1-644s21c1
Sequence:CCGGGAGGAGACTGACAGAGGAATTCTCGAGAATTCCTCTGTCAGTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013393.1-701s21c1
Sequence:CCGGGAAAGAGTCATCAGAAGTGTACTCGAGTACACTTCTGATGACTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013393.1-359s21c1
Sequence:CCGGGGTAGATCTTCTTCACATATTCTCGAGAATATGTGAAGAAGATCTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_013393.1-665s1c1
Sequence:CCGGCCAGAATGTAAGGATCATCAACTCGAGTTGATGATCCTTACATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013393.1-137s1c1
Sequence:CCGGCCGACATCTCAGGGACCCATTCTCGAGAATGGGTCCCTGAGATGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_013393.1-425s1c1
Sequence:CCGGCCCGAGAACCTCACAGAGAATCTCGAGATTCTCTGTGAGGTTCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_013393.1-701s1c1
Sequence:CCGGGAAAGAGTCATCAGAAGTGTACTCGAGTACACTTCTGATGACTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013393.1-644s1c1
Sequence:CCGGGAGGAGACTGACAGAGGAATTCTCGAGAATTCCTCTGTCAGTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013393
VALIDATED
FTSJ2 MISSION shRNA Lentiviral Transduction Particles
FtsJ RNA methyltransferase homolog 2 (E. coli)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013393.1-1112s21c1
Sequence:CCGGTTGACGGGACTTCATCTTATACTCGAGTATAAGATGAAGTCCCGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013393.1-217s21c1
Sequence:CCGGTGAACGAGAGGCACCAGATTCCTCGAGGAATCTGGTGCCTCTCGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013393.1-644s21c1
Sequence:CCGGGAGGAGACTGACAGAGGAATTCTCGAGAATTCCTCTGTCAGTCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013393.1-701s21c1
Sequence:CCGGGAAAGAGTCATCAGAAGTGTACTCGAGTACACTTCTGATGACTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013393.1-359s21c1
Sequence:CCGGGGTAGATCTTCTTCACATATTCTCGAGAATATGTGAAGAAGATCTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_013393.1-665s1c1
Sequence:CCGGCCAGAATGTAAGGATCATCAACTCGAGTTGATGATCCTTACATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013393.1-137s1c1
Sequence:CCGGCCGACATCTCAGGGACCCATTCTCGAGAATGGGTCCCTGAGATGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_013393.1-425s1c1
Sequence:CCGGCCCGAGAACCTCACAGAGAATCTCGAGATTCTCTGTGAGGTTCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_013393.1-701s1c1
Sequence:CCGGGAAAGAGTCATCAGAAGTGTACTCGAGTACACTTCTGATGACTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013393.1-644s1c1
Sequence:CCGGGAGGAGACTGACAGAGGAATTCTCGAGAATTCCTCTGTCAGTCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026510
VALIDATED
FTSJ2 MISSION shRNA Bacterial Glycerol Stock
FtsJ RNA methyltransferase homolog 2 (E. coli)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026510.1-718s21c1
Sequence:CCGGCTTCGGAGGTGTACCTGTTAGCTCGAGCTAACAGGTACACCTCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026510.1-525s21c1
Sequence:CCGGAGAGACCTCGATCACGATAAGCTCGAGCTTATCGTGATCGAGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026510.1-368s21c1
Sequence:CCGGGGTCGATCTCCTTCACATATTCTCGAGAATATGTGAAGGAGATCGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026510.1-472s21c1
Sequence:CCGGGCAGGAGAGCAGATGTGATTCCTCGAGGAATCACATCTGCTCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026510.1-1021s21c1
Sequence:CCGGCACGCAGGCTGCACACAATATCTCGAGATATTGTGTGCAGCCTGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026510.1-1031s1c1
Sequence:CCGGGCACACAATATGAACAGATATCTCGAGATATCTGTTCATATTGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026510.1-524s1c1
Sequence:CCGGCAGAGACCTCGATCACGATAACTCGAGTTATCGTGATCGAGGTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026510.1-1204s1c1
Sequence:CCGGGTAGCCTGAGTTGTATGAGAACTCGAGTTCTCATACAACTCAGGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026510
VALIDATED
FTSJ2 MISSION shRNA shRNA Plasmid DNA
FtsJ RNA methyltransferase homolog 2 (E. coli)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026510.1-718s21c1
Sequence:CCGGCTTCGGAGGTGTACCTGTTAGCTCGAGCTAACAGGTACACCTCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026510.1-525s21c1
Sequence:CCGGAGAGACCTCGATCACGATAAGCTCGAGCTTATCGTGATCGAGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026510.1-368s21c1
Sequence:CCGGGGTCGATCTCCTTCACATATTCTCGAGAATATGTGAAGGAGATCGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026510.1-472s21c1
Sequence:CCGGGCAGGAGAGCAGATGTGATTCCTCGAGGAATCACATCTGCTCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026510.1-1021s21c1
Sequence:CCGGCACGCAGGCTGCACACAATATCTCGAGATATTGTGTGCAGCCTGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026510.1-1031s1c1
Sequence:CCGGGCACACAATATGAACAGATATCTCGAGATATCTGTTCATATTGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026510.1-524s1c1
Sequence:CCGGCAGAGACCTCGATCACGATAACTCGAGTTATCGTGATCGAGGTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026510.1-1204s1c1
Sequence:CCGGGTAGCCTGAGTTGTATGAGAACTCGAGTTCTCATACAACTCAGGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026510
VALIDATED
FTSJ2 MISSION shRNA Lentiviral Transduction Particles
FtsJ RNA methyltransferase homolog 2 (E. coli)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026510.1-718s21c1
Sequence:CCGGCTTCGGAGGTGTACCTGTTAGCTCGAGCTAACAGGTACACCTCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026510.1-525s21c1
Sequence:CCGGAGAGACCTCGATCACGATAAGCTCGAGCTTATCGTGATCGAGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026510.1-368s21c1
Sequence:CCGGGGTCGATCTCCTTCACATATTCTCGAGAATATGTGAAGGAGATCGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026510.1-472s21c1
Sequence:CCGGGCAGGAGAGCAGATGTGATTCCTCGAGGAATCACATCTGCTCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026510.1-1021s21c1
Sequence:CCGGCACGCAGGCTGCACACAATATCTCGAGATATTGTGTGCAGCCTGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026510.1-1031s1c1
Sequence:CCGGGCACACAATATGAACAGATATCTCGAGATATCTGTTCATATTGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026510.1-524s1c1
Sequence:CCGGCAGAGACCTCGATCACGATAACTCGAGTTATCGTGATCGAGGTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026510.1-1204s1c1
Sequence:CCGGGTAGCCTGAGTTGTATGAGAACTCGAGTTCTCATACAACTCAGGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)