EMAIL THIS PAGE TO A FRIEND

FTSJ3

FtsJ homolog 3 (E. coli)

71 Gene Product Result for
Synonyms: EPCS3 SPB1
Gene ID:
Human(117246) Summary: Although the function of this gene is not known, the existence of this gene is supported by mRNA and EST data. A possible function of the encoded protein can be inferred from amino acid sequence similarity to the E.coli FtsJ protein and to a mouse protein possibly involved in embryogenesis. [provided by RefSeq, Jul 2008]
Mouse(56095) FtsJ homolog 3 (E. coli)
Rat(303608) FtsJ homolog 3 (E. coli)
chicken(419943) FtsJ homolog 3 (E. coli)
cow(508497) FtsJ homolog 3 (E. coli)
domestic cat(101097112) FtsJ homolog 3 (E. coli)
dog(490911) FtsJ homolog 3 (E. coli)
sheep(101103824) FtsJ homolog 3 (E. coli)
naked mole-rat(101709144) FtsJ homolog 3 (E. coli)
domestic guinea pig(100716899) FtsJ homolog 3 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025310 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025310 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025310 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017647 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017647 Rosetta Predictions human pricing
NM_001012014 Rosetta Predictions rat pricing
XM_001081570 Rosetta Predictions rat pricing
XM_573209 Rosetta Predictions rat pricing
NM_025310 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197928 predicted 1517
2 SASI_Hs01_00197929 predicted 274
3 SASI_Hs01_00197930 predicted 1421
4 SASI_Hs01_00197932 predicted 748
5 SASI_Hs01_00197933 predicted 878
6 SASI_Hs02_00350347 predicted 873
7 SASI_Hs02_00350348 predicted 2043
8 SASI_Hs01_00197934 predicted 2000
9 SASI_Hs01_00197935 predicted 715
10 SASI_Hs01_00197936 predicted 478
11 SASI_Hs01_00197927 predicted 739
12 SASI_Hs01_00197931 predicted 1930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100906 predicted 618
2 SASI_Rn01_00100907 predicted 2461
3 SASI_Rn01_00100908 predicted 692
4 SASI_Rn01_00100910 predicted 1910
5 SASI_Rn01_00100911 predicted 684
6 SASI_Rn01_00100913 predicted 1965
7 SASI_Rn01_00100914 predicted 2071
8 SASI_Rn01_00100915 predicted 1355
9 SASI_Rn02_00200095 predicted 452
10 SASI_Rn02_00200096 predicted 1619
11 SASI_Rn01_00100909 predicted 1526
12 SASI_Rn01_00100912 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081570 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372475 predicted 603
2 SASI_Rn02_00372476 predicted 2482
3 SASI_Rn02_00372477 predicted 678
4 SASI_Rn02_00372478 predicted 1936
5 SASI_Rn02_00372479 predicted 666
6 SASI_Rn02_00372480 predicted 1981
7 SASI_Rn02_00372481 predicted 2094
8 SASI_Rn02_00372482 predicted 1376
9 SASI_Rn02_00372483 predicted 440
10 SASI_Rn02_00372484 predicted 1635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00189016 predicted 629
2 SASI_Rn01_00189017 predicted 2466
3 SASI_Rn01_00189018 predicted 705
4 SASI_Rn01_00189019 predicted 1531
5 SASI_Rn01_00189020 predicted 1923
6 SASI_Rn01_00189021 predicted 680
7 SASI_Rn01_00189022 predicted 875
8 SASI_Rn01_00189023 predicted 1965
9 SASI_Rn01_00189024 predicted 2071
10 SASI_Rn01_00189025 predicted 1354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068994 predicted 2429
2 SASI_Mm01_00068995 predicted 1974
3 SASI_Mm01_00068996 predicted 1527
4 SASI_Mm01_00068997 predicted 533
5 SASI_Mm01_00068998 predicted 1442
6 SASI_Mm01_00068999 predicted 742
7 SASI_Mm01_00069000 predicted 684
8 SASI_Mm01_00069001 predicted 1990
9 SASI_Mm01_00069002 predicted 696
10 SASI_Mm01_00069003 predicted 713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025310
VALIDATED
FTSJ3 MISSION shRNA Bacterial Glycerol Stock
FtsJ homolog 3 (E. coli)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025310.2-972s1c1
Sequence:CCGGCGAAAGGAACTTAGGTCTCTTCTCGAGAAGAGACCTAAGTTCCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215595    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025310.2-2684s1c1
Sequence:CCGGGAAAGCACTGAGGAAACATTTCTCGAGAAATGTTTCCTCAGTGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025310.2-1338s21c1
Sequence:CCGGATCCGTGGCCAGCAGTTATTACTCGAGTAATAACTGCTGGCCACGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025310.2-677s21c1
Sequence:CCGGGGACAAGGTTGATGCTAAATTCTCGAGAATTTAGCATCAACCTTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025310.2-1545s21c1
Sequence:CCGGACTCAAGTAGATGACAATAAACTCGAGTTTATTGTCATCTACTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025310.2-2668s21c1
Sequence:CCGGTACAGAGGAGTACCATGAAAGCTCGAGCTTTCATGGTACTCCTCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025310.2-1984s21c1
Sequence:CCGGGGTTTGAGGTGGTGCCTATTCCTCGAGGAATAGGCACCACCTCAAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025310
VALIDATED
FTSJ3 MISSION shRNA shRNA Plasmid DNA
FtsJ homolog 3 (E. coli)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025310.2-972s1c1
Sequence:CCGGCGAAAGGAACTTAGGTCTCTTCTCGAGAAGAGACCTAAGTTCCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215595    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025310.2-2684s1c1
Sequence:CCGGGAAAGCACTGAGGAAACATTTCTCGAGAAATGTTTCCTCAGTGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025310.2-1338s21c1
Sequence:CCGGATCCGTGGCCAGCAGTTATTACTCGAGTAATAACTGCTGGCCACGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025310.2-677s21c1
Sequence:CCGGGGACAAGGTTGATGCTAAATTCTCGAGAATTTAGCATCAACCTTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025310.2-1545s21c1
Sequence:CCGGACTCAAGTAGATGACAATAAACTCGAGTTTATTGTCATCTACTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025310.2-2668s21c1
Sequence:CCGGTACAGAGGAGTACCATGAAAGCTCGAGCTTTCATGGTACTCCTCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025310.2-1984s21c1
Sequence:CCGGGGTTTGAGGTGGTGCCTATTCCTCGAGGAATAGGCACCACCTCAAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025310
VALIDATED
FTSJ3 MISSION shRNA Lentiviral Transduction Particles
FtsJ homolog 3 (E. coli)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025310.2-972s1c1
Sequence:CCGGCGAAAGGAACTTAGGTCTCTTCTCGAGAAGAGACCTAAGTTCCTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215595    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025310.2-2684s1c1
Sequence:CCGGGAAAGCACTGAGGAAACATTTCTCGAGAAATGTTTCCTCAGTGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025310.2-1338s21c1
Sequence:CCGGATCCGTGGCCAGCAGTTATTACTCGAGTAATAACTGCTGGCCACGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025310.2-677s21c1
Sequence:CCGGGGACAAGGTTGATGCTAAATTCTCGAGAATTTAGCATCAACCTTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025310.2-1545s21c1
Sequence:CCGGACTCAAGTAGATGACAATAAACTCGAGTTTATTGTCATCTACTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025310.2-2668s21c1
Sequence:CCGGTACAGAGGAGTACCATGAAAGCTCGAGCTTTCATGGTACTCCTCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025310.2-1984s21c1
Sequence:CCGGGGTTTGAGGTGGTGCCTATTCCTCGAGGAATAGGCACCACCTCAAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017647
VALIDATED
FTSJ3 MISSION shRNA Bacterial Glycerol Stock
FtsJ homolog 3 (E. coli)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017647.2-2827s1c1
Sequence:CCGGCTGAACTGTGTTGACACTCATCTCGAGATGAGTGTCAACACAGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017647.2-2012s1c1
Sequence:CCGGCGGGTTTGAGATAGTGCCTATCTCGAGATAGGCACTATCTCAAACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017647.2-2571s1c1
Sequence:CCGGGCACAGCAACGTAAGGAACAACTCGAGTTGTTCCTTACGTTGCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017647.2-1398s1c1
Sequence:CCGGGCAGACACATTTCTGTCCGATCTCGAGATCGGACAGAAATGTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017647.2-2414s1c1
Sequence:CCGGGCTGCGAAGTCTCTACAAGAACTCGAGTTCTTGTAGAGACTTCGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017647.2-248s1c1
Sequence:CCGGGCAGGTAGCTGCCAAGTTTATCTCGAGATAAACTTGGCAGCTACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017647.3-3146s21c1
Sequence:CCGGGCACAGCAACGTAAGGAACAACTCGAGTTGTTCCTTACGTTGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_017647.3-1555s21c1
Sequence:CCGGGGAGCTCAGGTCGCTACTAAACTCGAGTTTAGTAGCGACCTGAGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_017647.3-3410s21c1
Sequence:CCGGTGTTGACACTCATGACCCTTTCTCGAGAAAGGGTCATGAGTGTCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017647.3-1973s21c1
Sequence:CCGGGCAGACACATTTCTGTCCGATCTCGAGATCGGACAGAAATGTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_017647.3-1325s21c1
Sequence:CCGGGTTACTGAATTGGTTACTAAGCTCGAGCTTAGTAACCAATTCAGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017647
VALIDATED
FTSJ3 MISSION shRNA shRNA Plasmid DNA
FtsJ homolog 3 (E. coli)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017647.2-2827s1c1
Sequence:CCGGCTGAACTGTGTTGACACTCATCTCGAGATGAGTGTCAACACAGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017647.2-2012s1c1
Sequence:CCGGCGGGTTTGAGATAGTGCCTATCTCGAGATAGGCACTATCTCAAACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017647.2-2571s1c1
Sequence:CCGGGCACAGCAACGTAAGGAACAACTCGAGTTGTTCCTTACGTTGCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017647.2-1398s1c1
Sequence:CCGGGCAGACACATTTCTGTCCGATCTCGAGATCGGACAGAAATGTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017647.2-2414s1c1
Sequence:CCGGGCTGCGAAGTCTCTACAAGAACTCGAGTTCTTGTAGAGACTTCGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017647.2-248s1c1
Sequence:CCGGGCAGGTAGCTGCCAAGTTTATCTCGAGATAAACTTGGCAGCTACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017647.3-3146s21c1
Sequence:CCGGGCACAGCAACGTAAGGAACAACTCGAGTTGTTCCTTACGTTGCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_017647.3-1555s21c1
Sequence:CCGGGGAGCTCAGGTCGCTACTAAACTCGAGTTTAGTAGCGACCTGAGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_017647.3-3410s21c1
Sequence:CCGGTGTTGACACTCATGACCCTTTCTCGAGAAAGGGTCATGAGTGTCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017647.3-1973s21c1
Sequence:CCGGGCAGACACATTTCTGTCCGATCTCGAGATCGGACAGAAATGTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_017647.3-1325s21c1
Sequence:CCGGGTTACTGAATTGGTTACTAAGCTCGAGCTTAGTAACCAATTCAGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017647
VALIDATED
FTSJ3 MISSION shRNA Lentiviral Transduction Particles
FtsJ homolog 3 (E. coli)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017647.2-2827s1c1
Sequence:CCGGCTGAACTGTGTTGACACTCATCTCGAGATGAGTGTCAACACAGTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017647.2-2012s1c1
Sequence:CCGGCGGGTTTGAGATAGTGCCTATCTCGAGATAGGCACTATCTCAAACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017647.2-2571s1c1
Sequence:CCGGGCACAGCAACGTAAGGAACAACTCGAGTTGTTCCTTACGTTGCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017647.2-1398s1c1
Sequence:CCGGGCAGACACATTTCTGTCCGATCTCGAGATCGGACAGAAATGTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017647.2-2414s1c1
Sequence:CCGGGCTGCGAAGTCTCTACAAGAACTCGAGTTCTTGTAGAGACTTCGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017647.2-248s1c1
Sequence:CCGGGCAGGTAGCTGCCAAGTTTATCTCGAGATAAACTTGGCAGCTACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017647.3-3146s21c1
Sequence:CCGGGCACAGCAACGTAAGGAACAACTCGAGTTGTTCCTTACGTTGCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_017647.3-1555s21c1
Sequence:CCGGGGAGCTCAGGTCGCTACTAAACTCGAGTTTAGTAGCGACCTGAGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_017647.3-3410s21c1
Sequence:CCGGTGTTGACACTCATGACCCTTTCTCGAGAAAGGGTCATGAGTGTCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017647.3-1973s21c1
Sequence:CCGGGCAGACACATTTCTGTCCGATCTCGAGATCGGACAGAAATGTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_017647.3-1325s21c1
Sequence:CCGGGTTACTGAATTGGTTACTAAGCTCGAGCTTAGTAACCAATTCAGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)