EMAIL THIS PAGE TO A FRIEND

FUBP1

far upstream element (FUSE) binding protein 1

120 Gene Product Result for
Synonyms: FBP FUBP
UniProtKB ID: Q96AE4, Q12828
Gene ID:
Human(8880) Summary: This gene encodes a ssDNA binding protein that activates the far upstream element (FUSE) of c-myc and stimulates expression of c-myc in undifferentiated cells. Regulation of FUSE by FUBP occurs through single-strand binding of FUBP to the non-coding strand. This protein has been shown to function as an ATP-dependent DNA helicase. [provided by RefSeq, Jul 2008]
Mouse(51886) far upstream element (FUSE) binding protein 1
Rat(654496) far upstream element (FUSE) binding protein 1
sheep(101123163) far upstream element (FUSE) binding protein 1
Domestic Rabbit(100345436) far upstream element (FUSE) binding protein 1
domestic guinea pig(100713607) far upstream element (FUSE) binding protein 1
naked mole-rat(101700128) far upstream element (FUSE) binding protein 1
Zebrafish(406418) far upstream element (FUSE) binding protein 1
cow(513562) far upstream element (FUSE) binding protein 1
Horse(100066384) far upstream element (FUSE) binding protein 1
domestic cat(101092532) far upstream element (FUSE) binding protein 1
dog(490201) far upstream element (FUSE) binding protein 1
chicken(424551) far upstream element (FUSE) binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV35703 Anti-FUBP1 (AB1) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder human, zebrafish, mouse, rat, canine, bovine, chicken
western blot pricing
AV37732 Anti-FUBP1 (AB2) antibody produced in rabbit IgG fraction of antiserum , rat, human, canine, zebrafish, horse, rabbit, bovine, mouse, guinea pig
western blot pricing
SAB2502088 Anti-Fubp1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, pig, mouse, human, canine, bovine
ELISA, immunohistochemistry, western blot pricing
SAB2107931 Anti-FUBP1 antibody produced in rabbit IgG fraction of antiserum canine, human, guinea pig, rabbit, horse, bovine, pig, zebrafish, rat, mouse
western blot pricing
HPA006149 Anti-FUBP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100862 Anti-FUBP1 antibody produced in rabbit affinity isolated antibody bovine, human, rat, rabbit, canine, guinea pig, mouse
western blot pricing
WH0008880M1 Monoclonal Anti-FUBP1 antibody produced in mouse clone 3H4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1404648 Monoclonal Anti-FUBP1 antibody produced in mouse clone 1E10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_057172 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_057172 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_057172 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003902 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
ABE1330 Anti-FUSE-binding protein 1 Antibody 100 µg, ABE1330. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003902 Rosetta Predictions human pricing
NM_001037653 Rosetta Predictions rat pricing
XM_001068504 Rosetta Predictions rat pricing
NM_057172 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021944 predicted 362
2 SASI_Hs02_00336528 predicted 676
3 SASI_Hs01_00021945 predicted 832
4 SASI_Hs01_00021946 predicted 776
5 SASI_Hs01_00021947 predicted 1347
6 SASI_Hs01_00021948 predicted 803
7 SASI_Hs01_00021949 predicted 1758
8 SASI_Hs02_00336529 predicted 1210
9 SASI_Hs01_00021951 predicted 838
10 SASI_Hs01_00021952 predicted 1535
11 SASI_Hs01_00021950 predicted 866
12 SASI_Hs01_00021953 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077366 predicted 242
2 SASI_Rn01_00077367 predicted 744
3 SASI_Rn01_00077368 predicted 1348
4 SASI_Rn01_00077369 predicted 1654
5 SASI_Rn01_00077370 predicted 726
6 SASI_Rn01_00077371 predicted 699
7 SASI_Rn02_00204535 predicted 992
8 SASI_Rn01_00077373 predicted 440
9 SASI_Rn01_00077374 predicted 1344
10 SASI_Rn01_00077375 predicted 1284
11 SASI_Rn01_00077372 predicted 1493
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324725 predicted 270
2 SASI_Rn02_00324726 predicted 269
3 SASI_Rn02_00324727 predicted 343
4 SASI_Rn02_00324728 predicted 342
5 SASI_Rn02_00324729 predicted 250
6 SASI_Rn02_00324730 predicted 267
7 SASI_Rn02_00324731 predicted 346
8 SASI_Rn02_00324732 predicted 207
9 SASI_Rn02_00324733 predicted 232
10 SASI_Rn02_00324734 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194328 predicted 818
2 SASI_Mm02_00338058 predicted 574
3 SASI_Mm01_00194329 predicted 1430
4 SASI_Mm01_00194330 predicted 803
5 SASI_Mm01_00194331 predicted 518
6 SASI_Mm01_00194332 predicted 936
7 SASI_Mm01_00194333 predicted 1060
8 SASI_Mm02_00338059 predicted 855
9 SASI_Mm01_00194334 predicted 1418
10 SASI_Mm01_00194335 predicted 1368
11 SASI_Mm01_00194336 predicted 1013
12 SASI_Mm01_00194337 predicted 1675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_057172
VALIDATED
FUBP1 MISSION shRNA Bacterial Glycerol Stock
far upstream element (FUSE) binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_057172.3-1986s21c1
Sequence:CCGGTAGACAGCAAGCAGCGTATTACTCGAGTAATACGCTGCTTGCTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_057172.3-1943s21c1
Sequence:CCGGCAGGTGGTCAGCCGGATTATACTCGAGTATAATCCGGCTGACCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_057172.3-545s21c1
Sequence:CCGGGCCTACCAGAAAGGTCTTGTACTCGAGTACAAGACCTTTCTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057172.3-2494s21c1
Sequence:CCGGAGATACATGTACACGAATATACTCGAGTATATTCGTGTACATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_057172.3-444s21c1
Sequence:CCGGAGATGGGATGGTCGGATTTATCTCGAGATAAATCCGACCATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_057172.1-2152s1c1
Sequence:CCGGCCAATAATAAGAAGTGGACAACTCGAGTTGTCCACTTCTTATTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_057172.1-508s1c1
Sequence:CCGGGCCTACCAGAAAGGTCTTGTACTCGAGTACAAGACCTTTCTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057172.1-509s1c1
Sequence:CCGGCCTACCAGAAAGGTCTTGTATCTCGAGATACAAGACCTTTCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057172.1-1089s1c1
Sequence:CCGGGCAGAAATAATCACAGACCTTCTCGAGAAGGTCTGTGATTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057172.1-1695s1c1
Sequence:CCGGGCTGCTTATTATGCTCACTATCTCGAGATAGTGAGCATAATAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_057172
VALIDATED
FUBP1 MISSION shRNA shRNA Plasmid DNA
far upstream element (FUSE) binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_057172.3-1986s21c1
Sequence:CCGGTAGACAGCAAGCAGCGTATTACTCGAGTAATACGCTGCTTGCTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_057172.3-1943s21c1
Sequence:CCGGCAGGTGGTCAGCCGGATTATACTCGAGTATAATCCGGCTGACCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_057172.3-545s21c1
Sequence:CCGGGCCTACCAGAAAGGTCTTGTACTCGAGTACAAGACCTTTCTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057172.3-2494s21c1
Sequence:CCGGAGATACATGTACACGAATATACTCGAGTATATTCGTGTACATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_057172.3-444s21c1
Sequence:CCGGAGATGGGATGGTCGGATTTATCTCGAGATAAATCCGACCATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_057172.1-2152s1c1
Sequence:CCGGCCAATAATAAGAAGTGGACAACTCGAGTTGTCCACTTCTTATTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_057172.1-508s1c1
Sequence:CCGGGCCTACCAGAAAGGTCTTGTACTCGAGTACAAGACCTTTCTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057172.1-509s1c1
Sequence:CCGGCCTACCAGAAAGGTCTTGTATCTCGAGATACAAGACCTTTCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057172.1-1089s1c1
Sequence:CCGGGCAGAAATAATCACAGACCTTCTCGAGAAGGTCTGTGATTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057172.1-1695s1c1
Sequence:CCGGGCTGCTTATTATGCTCACTATCTCGAGATAGTGAGCATAATAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_057172
VALIDATED
FUBP1 MISSION shRNA Lentiviral Transduction Particles
far upstream element (FUSE) binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_057172.3-1986s21c1
Sequence:CCGGTAGACAGCAAGCAGCGTATTACTCGAGTAATACGCTGCTTGCTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_057172.3-1943s21c1
Sequence:CCGGCAGGTGGTCAGCCGGATTATACTCGAGTATAATCCGGCTGACCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_057172.3-545s21c1
Sequence:CCGGGCCTACCAGAAAGGTCTTGTACTCGAGTACAAGACCTTTCTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057172.3-2494s21c1
Sequence:CCGGAGATACATGTACACGAATATACTCGAGTATATTCGTGTACATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_057172.3-444s21c1
Sequence:CCGGAGATGGGATGGTCGGATTTATCTCGAGATAAATCCGACCATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_057172.1-2152s1c1
Sequence:CCGGCCAATAATAAGAAGTGGACAACTCGAGTTGTCCACTTCTTATTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_057172.1-508s1c1
Sequence:CCGGGCCTACCAGAAAGGTCTTGTACTCGAGTACAAGACCTTTCTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057172.1-509s1c1
Sequence:CCGGCCTACCAGAAAGGTCTTGTATCTCGAGATACAAGACCTTTCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057172.1-1089s1c1
Sequence:CCGGGCAGAAATAATCACAGACCTTCTCGAGAAGGTCTGTGATTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057172.1-1695s1c1
Sequence:CCGGGCTGCTTATTATGCTCACTATCTCGAGATAGTGAGCATAATAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003902
VALIDATED
FUBP1 MISSION shRNA Bacterial Glycerol Stock
far upstream element (FUSE) binding protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003902.3-797s21c1
Sequence:GTACCGGGATTACAGGAGACCCATATAACTCGAGTTATATGGGTCTCCTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003902.3-2005s21c1
Sequence:CCGGCAGCACCTCAGGGCCAATAATCTCGAGATTATTGGCCCTGAGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003902.3-1539s21c1
Sequence:CCGGTACAACCCTGCACCTTATAATCTCGAGATTATAAGGTGCAGGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003902.3-2187s21c1
Sequence:CCGGACTACTGATAGGAGGTTAATACTCGAGTATTAACCTCCTATCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003902.3-1704s21c1
Sequence:CCGGGCTTATTACGCTCACTATTATCTCGAGATAATAGTGAGCGTAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003902.2-2035s1c1
Sequence:CCGGCGACTTGATGAAGATCTTAATCTCGAGATTAAGATCTTCATCAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003902.2-981s1c1
Sequence:CCGGCCCGAAAGGATAGCACAAATACTCGAGTATTTGTGCTATCCTTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003902.2-222s1c1
Sequence:CCGGCCTTTAGAAGATGGAGATCAACTCGAGTTGATCTCCATCTTCTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003902.2-1638s1c1
Sequence:CCGGGCTGCTTATTACGCTCACTATCTCGAGATAGTGAGCGTAATAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003902
VALIDATED
FUBP1 MISSION shRNA shRNA Plasmid DNA
far upstream element (FUSE) binding protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003902.3-797s21c1
Sequence:GTACCGGGATTACAGGAGACCCATATAACTCGAGTTATATGGGTCTCCTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003902.3-2005s21c1
Sequence:CCGGCAGCACCTCAGGGCCAATAATCTCGAGATTATTGGCCCTGAGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003902.3-1539s21c1
Sequence:CCGGTACAACCCTGCACCTTATAATCTCGAGATTATAAGGTGCAGGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003902.3-2187s21c1
Sequence:CCGGACTACTGATAGGAGGTTAATACTCGAGTATTAACCTCCTATCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003902.3-1704s21c1
Sequence:CCGGGCTTATTACGCTCACTATTATCTCGAGATAATAGTGAGCGTAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003902.2-2035s1c1
Sequence:CCGGCGACTTGATGAAGATCTTAATCTCGAGATTAAGATCTTCATCAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003902.2-981s1c1
Sequence:CCGGCCCGAAAGGATAGCACAAATACTCGAGTATTTGTGCTATCCTTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003902.2-222s1c1
Sequence:CCGGCCTTTAGAAGATGGAGATCAACTCGAGTTGATCTCCATCTTCTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003902.2-1638s1c1
Sequence:CCGGGCTGCTTATTACGCTCACTATCTCGAGATAGTGAGCGTAATAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003902
VALIDATED
FUBP1 MISSION shRNA Lentiviral Transduction Particles
far upstream element (FUSE) binding protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003902.3-797s21c1
Sequence:GTACCGGGATTACAGGAGACCCATATAACTCGAGTTATATGGGTCTCCTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003902.3-2005s21c1
Sequence:CCGGCAGCACCTCAGGGCCAATAATCTCGAGATTATTGGCCCTGAGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003902.3-1539s21c1
Sequence:CCGGTACAACCCTGCACCTTATAATCTCGAGATTATAAGGTGCAGGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003902.3-2187s21c1
Sequence:CCGGACTACTGATAGGAGGTTAATACTCGAGTATTAACCTCCTATCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003902.3-1704s21c1
Sequence:CCGGGCTTATTACGCTCACTATTATCTCGAGATAATAGTGAGCGTAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003902.2-2035s1c1
Sequence:CCGGCGACTTGATGAAGATCTTAATCTCGAGATTAAGATCTTCATCAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003902.2-981s1c1
Sequence:CCGGCCCGAAAGGATAGCACAAATACTCGAGTATTTGTGCTATCCTTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003902.2-222s1c1
Sequence:CCGGCCTTTAGAAGATGGAGATCAACTCGAGTTGATCTCCATCTTCTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003902.2-1638s1c1
Sequence:CCGGGCTGCTTATTACGCTCACTATCTCGAGATAGTGAGCGTAATAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks