EMAIL THIS PAGE TO A FRIEND

FUBP3

far upstream element (FUSE) binding protein 3

219 Gene Product Result for
Synonyms: FBP3
UniProtKB ID: Q96I24, A3KFK8, A3KFL0, Q92946, Q9BVB6
Gene ID:
Mouse(320267) far upstream element (FUSE) binding protein 3
Rat(362106) far upstream element (FUSE) binding protein 3
Zebrafish(493616) far upstream element (FUSE) binding protein 3
cow(541080) far upstream element (FUSE) binding protein 3
Horse(100069755) far upstream element (FUSE) binding protein 3
domestic cat(101086931) far upstream element (FUSE) binding protein 3
dog(608171) far upstream element (FUSE) binding protein 3
chicken(417184) far upstream element (FUSE) binding protein 3
naked mole-rat(101726262) far upstream element (FUSE) binding protein 3
domestic guinea pig(100731566) far upstream element (FUSE) binding protein 3
sheep(101123458) far upstream element (FUSE) binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376917 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033389 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033389 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033389 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063321 MISSION® esiRNA esiRNA human FUBP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003934 Rosetta Predictions human pricing
NM_001039337 Rosetta Predictions rat pricing
NM_001033389 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158414 predicted 876
2 SASI_Hs01_00158415 predicted 1174
3 SASI_Hs01_00158416 predicted 964
4 SASI_Hs01_00158417 predicted 783
5 SASI_Hs01_00158418 predicted 742
6 SASI_Hs01_00158419 predicted 1771
7 SASI_Hs01_00158420 predicted 598
8 SASI_Hs01_00158421 predicted 1043
9 SASI_Hs01_00158422 predicted 692
10 SASI_Hs01_00158423 predicted 1367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079190 predicted 613
2 SASI_Rn01_00079191 predicted 209
3 SASI_Rn01_00079192 predicted 1378
4 SASI_Rn01_00079193 predicted 665
5 SASI_Rn01_00079194 predicted 235
6 SASI_Rn02_00204816 predicted 1067
7 SASI_Rn01_00079196 predicted 636
8 SASI_Rn01_00079197 predicted 485
9 SASI_Rn01_00079198 predicted 974
10 SASI_Rn01_00079199 predicted 779
11 SASI_Rn01_00079195 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024552 predicted 381
2 SASI_Mm01_00024553 predicted 258
3 SASI_Mm01_00024554 predicted 1421
4 SASI_Mm01_00024555 predicted 538
5 SASI_Mm01_00024556 predicted 669
6 SASI_Mm01_00024557 predicted 279
7 SASI_Mm01_00024558 predicted 719
8 SASI_Mm01_00024559 predicted 602
9 SASI_Mm01_00024560 predicted 833
10 SASI_Mm01_00024561 predicted 695
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376917
VALIDATED
FUBP3 MISSION shRNA Bacterial Glycerol Stock
far upstream element (FUSE) binding protein 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376917.1-718s1c1
Sequence:CCGGCCTCTTCGTATCACTGGAGATCTCGAGATCTCCAGTGATACGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376917.1-819s1c1
Sequence:CCGGCGGCGATTTCAACTCTCGAATCTCGAGATTCGAGAGTTGAAATCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376917.1-541s1c1
Sequence:CCGGCCTGGCTTTCATAATGACATACTCGAGTATGTCATTATGAAAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376917.1-312s1c1
Sequence:CCGGGACGGTAATAACGGAAGAATTCTCGAGAATTCTTCCGTTATTACCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376917.1-1029s1c1
Sequence:CCGGGCATATCATCAGCGAGCTGATCTCGAGATCAGCTCGCTGATGATATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376917
VALIDATED
FUBP3 MISSION shRNA shRNA Plasmid DNA
far upstream element (FUSE) binding protein 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376917.1-718s1c1
Sequence:CCGGCCTCTTCGTATCACTGGAGATCTCGAGATCTCCAGTGATACGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376917.1-819s1c1
Sequence:CCGGCGGCGATTTCAACTCTCGAATCTCGAGATTCGAGAGTTGAAATCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376917.1-541s1c1
Sequence:CCGGCCTGGCTTTCATAATGACATACTCGAGTATGTCATTATGAAAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376917.1-312s1c1
Sequence:CCGGGACGGTAATAACGGAAGAATTCTCGAGAATTCTTCCGTTATTACCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376917.1-1029s1c1
Sequence:CCGGGCATATCATCAGCGAGCTGATCTCGAGATCAGCTCGCTGATGATATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376917
VALIDATED
FUBP3 MISSION shRNA Lentiviral Transduction Particles
far upstream element (FUSE) binding protein 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376917.1-718s1c1
Sequence:CCGGCCTCTTCGTATCACTGGAGATCTCGAGATCTCCAGTGATACGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376917.1-819s1c1
Sequence:CCGGCGGCGATTTCAACTCTCGAATCTCGAGATTCGAGAGTTGAAATCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376917.1-541s1c1
Sequence:CCGGCCTGGCTTTCATAATGACATACTCGAGTATGTCATTATGAAAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376917.1-312s1c1
Sequence:CCGGGACGGTAATAACGGAAGAATTCTCGAGAATTCTTCCGTTATTACCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_376917.1-1029s1c1
Sequence:CCGGGCATATCATCAGCGAGCTGATCTCGAGATCAGCTCGCTGATGATATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033389
FUBP3 MISSION shRNA Bacterial Glycerol Stock
far upstream element (FUSE) binding protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033389.2-506s21c1
Sequence:CCGGGCCTGGCTTTCACAACGATATCTCGAGATATCGTTGTGAAAGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033389.2-2479s21c1
Sequence:CCGGACTAAACATTGCTGGTAATTTCTCGAGAAATTACCAGCAATGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033389.2-1248s21c1
Sequence:CCGGGACCCTAACCTGCGGATATTTCTCGAGAAATATCCGCAGGTTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033389.2-692s21c1
Sequence:CCGGCATCACTGGAGACCCATTTAACTCGAGTTAAATGGGTCTCCAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033389.2-857s21c1
Sequence:CCGGCATAGGAAGGAACGGAGAAATCTCGAGATTTCTCCGTTCCTTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033389
FUBP3 MISSION shRNA shRNA Plasmid DNA
far upstream element (FUSE) binding protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033389.2-506s21c1
Sequence:CCGGGCCTGGCTTTCACAACGATATCTCGAGATATCGTTGTGAAAGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033389.2-2479s21c1
Sequence:CCGGACTAAACATTGCTGGTAATTTCTCGAGAAATTACCAGCAATGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033389.2-1248s21c1
Sequence:CCGGGACCCTAACCTGCGGATATTTCTCGAGAAATATCCGCAGGTTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033389.2-692s21c1
Sequence:CCGGCATCACTGGAGACCCATTTAACTCGAGTTAAATGGGTCTCCAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033389.2-857s21c1
Sequence:CCGGCATAGGAAGGAACGGAGAAATCTCGAGATTTCTCCGTTCCTTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033389
FUBP3 MISSION shRNA Lentiviral Transduction Particles
far upstream element (FUSE) binding protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033389.2-506s21c1
Sequence:CCGGGCCTGGCTTTCACAACGATATCTCGAGATATCGTTGTGAAAGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033389.2-2479s21c1
Sequence:CCGGACTAAACATTGCTGGTAATTTCTCGAGAAATTACCAGCAATGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033389.2-1248s21c1
Sequence:CCGGGACCCTAACCTGCGGATATTTCTCGAGAAATATCCGCAGGTTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033389.2-692s21c1
Sequence:CCGGCATCACTGGAGACCCATTTAACTCGAGTTAAATGGGTCTCCAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033389.2-857s21c1
Sequence:CCGGCATAGGAAGGAACGGAGAAATCTCGAGATTTCTCCGTTCCTTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks